Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FLT3 cdna clone

FLT3 cDNA Clone

Gene Names
FLT3; FLK2; STK1; CD135; FLK-2
Synonyms
FLT3; FLT3 cDNA Clone; FLT3 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggcgttggcgcgcgacggcggccagctgccgctgctcgttgttttttctgcaatgatatttgggactattacaaatcaagatctgcctgtgatcaagtgtgttttaatcaatcataagaacaatgattcatcagtggggaagtcatcatcatatcccatggtatcagaatccccggaagacctcgggtgtgcgttgagaccccagagctcagggacagtgtacgaagctgccgctgtggaagtggatgtatctgcttccatcacactgcaagtgctggtcgatgccccagggaacatttcctgtctctgggtctttaagcacagctccctgaattgccagccacattttgatttacaaaacagaggagttgtttccatggtcattttgaaaatgacagaaacccaagctggagaatacctactttttattcagagtgaagctaccaattacacaatattgtttacagtgagtataagaaataccctgctttacacattaagaagaccttactttagaaaaatggaaaaccaggacgccctggtctgcatatctgagagcgttccagagccgatcgtggaatgggtgctttgcgattcacagggggaaagctgtaaagaagaaagtccagctgttgttaaaaaggaggaaaaagtgcttcatgaattatttgggatggacataaggtgctgtgccagaaatgaactgggcagggaatgcaccaggctgttcacaatagatctaaatcaaactcctcagaccacattgccacaattatttcttaaagtaggggaacccttatggataaggtgcaaagctgttcatgtgaaccatggattcgggctcacctgggaattagaaaacaaagcactcgaggagggcaactactttgagatgagtacctattcaacaaacagaactatgatacggattctgtttgcttttgtatcatcagtggcaagaaacgacaccggatactacacttgttcctcttcaaagcatcccagtcaatcagctttggttaccatcgtagaaaagggatttataaatgctaccaattcaagtgaagattatgaaattgaccaatatgaagagttttgtttttctgtcaggtttaaagcctacccacaaatcagatgtacgtggaccttctctcgaaaatcatttccttgtgagcaaaagggtcttgataacggatacagcatatccaagttttgcaatcataagcaccagccaggagaatatatattccatgcagaaaatgatgatgcccaatttaccaaaatgttcacgctgaatataagaaggaaacctcaagtgctcgcagaagcatcggcaagtcaggcgtcctgtttctcggatggatacccattaccatcttggacctggaagaagtgttcagacaagtctcccaactgcacagaagagatcacagaaggagtctggaatagaaaggctaacagaaaagtgtttggacagtgggtgtcgagcagtactctaaacatgagtgaagccataaaagggttcctggtcaagtgctgtgcatacaattcccttggcacatcttgtgagacgatccttttaaactctccaggccccttccctttcatccaagacaacatctcattctatgcaacaattggtgtttgtctcctcttcattgtcgttttaaccctgctaatttgtcacaagtacaaaaagcaatttaggtatgaaagccagctacagatggtacaggtgaccggctcctcagataatgagtacttctacgttgatttcagagaatatgaatatgatctcaaatgggagtttccaagagaaaatttagagtttgggaaggtactaggatcaggtgcttttggaaaagtgatgaacgcaacagcttatggaattagcaaaacaggagtctcaatccaggttgccgtcaaaatgctgaaagaaaaagcagacagctctgaaagagaggcactcatgtcagaactcaagatgatgacccagctgggaagccacgagaatattgtgaacctgctgggggcgtgcacactgtcaggaccaatttacttgatttttgaatactgttgctatggtgatcttctcaactatctaagaagtaaaagagaaaaatttcacaggacttggacagagattttcaaggaacacaatttcagtttttaccccactttccaatcacatccaaattccagcatgcctggttcaagagaagttcagatacacccggactcggatcaaatctcagggcttcatgggaattcatttcactctgaagatgaaattgaatatgaaaaccaaaaaaggctggaagaagaggaggacttgaatgtgcttacatttgaagatcttctttgctttgcatatcaagttgccaaaggaatggaatttctggaatttaagtcgtgtgttcacagagacctggccgccaggaacgtgcttgtcacccacgggaaagtggtgaagatatgtgactttggattggctcgagatatcatgagtgattccaactatgttgtcaggggcaatgcccgtctgcctgtaaaatggatggcccccgaaagcctgtttgaaggcatctacaccattaagagtgatgtctggtcatatggaatattactgtgggaaatcttctcacttggtgtgaatccttaccctggcattccggttgatgctaacttctacaaactgattcaaaatggatttaaaatggatcagccattttatgctacagaagaaatatacattataatgcaatcctgctgggcttttgactcaaggaaacggccatccttccctaatttgacttcgtttttaggatgtcagctggcagatgcagaagaagcgatgtatcagaatgtggatggccgtgtttcggaatgtcctcacacctaccaaaacaggcgacctttcagcagagagatggatttggggctactctctccgcaggctcaggtcgaagattcgtag
Sequence Length
2982
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
108,378 Da
NCBI Official Full Name
Homo sapiens fms-related tyrosine kinase 3, mRNA
NCBI Official Synonym Full Names
fms related tyrosine kinase 3
NCBI Official Symbol
FLT3
NCBI Official Synonym Symbols
FLK2; STK1; CD135; FLK-2
NCBI Protein Information
receptor-type tyrosine-protein kinase FLT3
UniProt Protein Name
Receptor-type tyrosine-protein kinase FLT3
UniProt Gene Name
FLT3
UniProt Synonym Gene Names
CD135; FLK2; STK1; FLK-2; FLT-3; STK-1
UniProt Entry Name
FLT3_HUMAN

NCBI Description

This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]

Uniprot Description

FLT3: a receptor tyrosine kinase of the PDGFR family that binds the FL cytokine. FLT3 -/- mice have an impaired developmental capacity of primitive hematopoietic progenitor cells of all lineages with the greatest impact on lymphopoietic precursors. Activating mutations found in one third of cases of acute myeloid leukemia (AML), as well as in acute lymphoblastic leukemia, acute promyelocytic leukemia and myelodysplastic syndrome. Inhibitors: Sutent and PKC412.

Protein type: Membrane protein, integral; EC 2.7.10.1; Protein kinase, TK; Kinase, protein; Oncoprotein; Protein kinase, tyrosine (receptor); TK group; PDGFR family

Chromosomal Location of Human Ortholog: 13q12

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: hematopoietin/interferon-class (D200-domain) cytokine receptor activity; protein binding; protein homodimerization activity; transmembrane receptor protein tyrosine kinase activity; vascular endothelial growth factor receptor activity

Biological Process: B cell differentiation; cytokine and chemokine mediated signaling pathway; hemopoiesis; leukocyte homeostasis; lymphocyte proliferation; myeloid progenitor cell differentiation; peptidyl-tyrosine phosphorylation; positive regulation of cell proliferation; positive regulation of MAP kinase activity; positive regulation of MAPKKK cascade; positive regulation of phosphoinositide 3-kinase activity; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of tyrosine phosphorylation of STAT protein; pro-B cell differentiation; protein amino acid autophosphorylation; regulation of apoptosis; transmembrane receptor protein tyrosine kinase signaling pathway

Disease: Leukemia, Acute Lymphoblastic

Research Articles on FLT3

Similar Products

Product Notes

The FLT3 flt3 (Catalog #AAA1278654) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggcgt tggcgcgcga cggcggccag ctgccgctgc tcgttgtttt ttctgcaatg atatttggga ctattacaaa tcaagatctg cctgtgatca agtgtgtttt aatcaatcat aagaacaatg attcatcagt ggggaagtca tcatcatatc ccatggtatc agaatccccg gaagacctcg ggtgtgcgtt gagaccccag agctcaggga cagtgtacga agctgccgct gtggaagtgg atgtatctgc ttccatcaca ctgcaagtgc tggtcgatgc cccagggaac atttcctgtc tctgggtctt taagcacagc tccctgaatt gccagccaca ttttgattta caaaacagag gagttgtttc catggtcatt ttgaaaatga cagaaaccca agctggagaa tacctacttt ttattcagag tgaagctacc aattacacaa tattgtttac agtgagtata agaaataccc tgctttacac attaagaaga ccttacttta gaaaaatgga aaaccaggac gccctggtct gcatatctga gagcgttcca gagccgatcg tggaatgggt gctttgcgat tcacaggggg aaagctgtaa agaagaaagt ccagctgttg ttaaaaagga ggaaaaagtg cttcatgaat tatttgggat ggacataagg tgctgtgcca gaaatgaact gggcagggaa tgcaccaggc tgttcacaat agatctaaat caaactcctc agaccacatt gccacaatta tttcttaaag taggggaacc cttatggata aggtgcaaag ctgttcatgt gaaccatgga ttcgggctca cctgggaatt agaaaacaaa gcactcgagg agggcaacta ctttgagatg agtacctatt caacaaacag aactatgata cggattctgt ttgcttttgt atcatcagtg gcaagaaacg acaccggata ctacacttgt tcctcttcaa agcatcccag tcaatcagct ttggttacca tcgtagaaaa gggatttata aatgctacca attcaagtga agattatgaa attgaccaat atgaagagtt ttgtttttct gtcaggttta aagcctaccc acaaatcaga tgtacgtgga ccttctctcg aaaatcattt ccttgtgagc aaaagggtct tgataacgga tacagcatat ccaagttttg caatcataag caccagccag gagaatatat attccatgca gaaaatgatg atgcccaatt taccaaaatg ttcacgctga atataagaag gaaacctcaa gtgctcgcag aagcatcggc aagtcaggcg tcctgtttct cggatggata cccattacca tcttggacct ggaagaagtg ttcagacaag tctcccaact gcacagaaga gatcacagaa ggagtctgga atagaaaggc taacagaaaa gtgtttggac agtgggtgtc gagcagtact ctaaacatga gtgaagccat aaaagggttc ctggtcaagt gctgtgcata caattccctt ggcacatctt gtgagacgat ccttttaaac tctccaggcc ccttcccttt catccaagac aacatctcat tctatgcaac aattggtgtt tgtctcctct tcattgtcgt tttaaccctg ctaatttgtc acaagtacaa aaagcaattt aggtatgaaa gccagctaca gatggtacag gtgaccggct cctcagataa tgagtacttc tacgttgatt tcagagaata tgaatatgat ctcaaatggg agtttccaag agaaaattta gagtttggga aggtactagg atcaggtgct tttggaaaag tgatgaacgc aacagcttat ggaattagca aaacaggagt ctcaatccag gttgccgtca aaatgctgaa agaaaaagca gacagctctg aaagagaggc actcatgtca gaactcaaga tgatgaccca gctgggaagc cacgagaata ttgtgaacct gctgggggcg tgcacactgt caggaccaat ttacttgatt tttgaatact gttgctatgg tgatcttctc aactatctaa gaagtaaaag agaaaaattt cacaggactt ggacagagat tttcaaggaa cacaatttca gtttttaccc cactttccaa tcacatccaa attccagcat gcctggttca agagaagttc agatacaccc ggactcggat caaatctcag ggcttcatgg gaattcattt cactctgaag atgaaattga atatgaaaac caaaaaaggc tggaagaaga ggaggacttg aatgtgctta catttgaaga tcttctttgc tttgcatatc aagttgccaa aggaatggaa tttctggaat ttaagtcgtg tgttcacaga gacctggccg ccaggaacgt gcttgtcacc cacgggaaag tggtgaagat atgtgacttt ggattggctc gagatatcat gagtgattcc aactatgttg tcaggggcaa tgcccgtctg cctgtaaaat ggatggcccc cgaaagcctg tttgaaggca tctacaccat taagagtgat gtctggtcat atggaatatt actgtgggaa atcttctcac ttggtgtgaa tccttaccct ggcattccgg ttgatgctaa cttctacaaa ctgattcaaa atggatttaa aatggatcag ccattttatg ctacagaaga aatatacatt ataatgcaat cctgctgggc ttttgactca aggaaacggc catccttccc taatttgact tcgtttttag gatgtcagct ggcagatgca gaagaagcga tgtatcagaa tgtggatggc cgtgtttcgg aatgtcctca cacctaccaa aacaggcgac ctttcagcag agagatggat ttggggctac tctctccgca ggctcaggtc gaagattcgt ag. It is sometimes possible for the material contained within the vial of "FLT3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.