Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FKBP1B cdna clone

FKBP1B cDNA Clone

Gene Names
FKBP1B; OTK4; FKBP1L; PKBP1L; PPIase; FKBP12.6
Synonyms
FKBP1B; FKBP1B cDNA Clone; FKBP1B cdna clone
Ordering
For Research Use Only!
Sequence
atgggcgtggagatcgagaccatctcccccggagacggaaggacattccccaagaagggccaaacgtgtgtggtgcactacacaggaatgctccaaaatgggaagaagtttgattcatccagagacagaaacaaacctttcaagttcagaattggcaaacaggaagtcatcaaaggttttgaagagggtgcagcccagctgggtcctctttctcctctccccatctgcccccatccctgctag
Sequence Length
243
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,802 Da
NCBI Official Full Name
Homo sapiens FK506 binding protein 1B, 12.6 kDa, mRNA
NCBI Official Synonym Full Names
FK506 binding protein 1B
NCBI Official Symbol
FKBP1B
NCBI Official Synonym Symbols
OTK4; FKBP1L; PKBP1L; PPIase; FKBP12.6
NCBI Protein Information
peptidyl-prolyl cis-trans isomerase FKBP1B
UniProt Protein Name
Peptidyl-prolyl cis-trans isomerase FKBP1B
UniProt Gene Name
FKBP1B
UniProt Synonym Gene Names
FKBP12.6; FKBP1L; FKBP9; OTK4; PPIase FKBP1B; 12.6 kDa FKBP; FKBP-12.6; FKBP-1B
UniProt Entry Name
FKB1B_HUMAN

NCBI Description

The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is highly similar to the FK506-binding protein 1A. Its physiological role is thought to be in excitation-contraction coupling in cardiac muscle. There are two alternatively spliced transcript variants of this gene encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

FKBP1B: Has the potential to contribute to the immunosuppressive and toxic effects of FK506 and rapamycin. PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. Belongs to the FKBP-type PPIase family. FKBP1 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Isomerase; EC 5.2.1.8

Chromosomal Location of Human Ortholog: 2p23.3

Cellular Component: cytoplasm; cytosol; membrane; sarcoplasmic reticulum membrane; Z disc

Molecular Function: calcium channel inhibitor activity; FK506 binding; peptidyl-prolyl cis-trans isomerase activity; protein binding; receptor binding; ryanodine-sensitive calcium-release channel activity

Biological Process: 'de novo' protein folding; cytosolic calcium ion homeostasis; negative regulation of heart rate; negative regulation of protein phosphatase type 2B activity; negative regulation of release of sequestered calcium ion into cytosol; positive regulation of sequestering of calcium ion; protein maturation via protein folding; protein peptidyl-prolyl isomerization; protein refolding; response to redox state

Research Articles on FKBP1B

Similar Products

Product Notes

The FKBP1B fkbp1b (Catalog #AAA1271690) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcgtgg agatcgagac catctccccc ggagacggaa ggacattccc caagaagggc caaacgtgtg tggtgcacta cacaggaatg ctccaaaatg ggaagaagtt tgattcatcc agagacagaa acaaaccttt caagttcaga attggcaaac aggaagtcat caaaggtttt gaagagggtg cagcccagct gggtcctctt tctcctctcc ccatctgccc ccatccctgc tag. It is sometimes possible for the material contained within the vial of "FKBP1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.