Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FKBP1A cdna clone

FKBP1A cDNA Clone

Gene Names
FKBP1A; FKBP1; PKC12; PKCI2; FKBP12; PPIASE; FKBP-12; FKBP-1A
Synonyms
FKBP1A; FKBP1A cDNA Clone; FKBP1A cdna clone
Ordering
For Research Use Only!
Sequence
ATGGGCAGGCAACGCGCTGAGGGACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCCGCCCGCTCAGCGTCCGCCGCCGCCATGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGA
Sequence Length
438
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,951 Da
NCBI Official Full Name
Homo sapiens FK506 binding protein 1A, 12kDa, mRNA
NCBI Official Synonym Full Names
FK506 binding protein 1A
NCBI Official Symbol
FKBP1A
NCBI Official Synonym Symbols
FKBP1; PKC12; PKCI2; FKBP12; PPIASE; FKBP-12; FKBP-1A
NCBI Protein Information
peptidyl-prolyl cis-trans isomerase FKBP1A
UniProt Protein Name
Peptidyl-prolyl cis-trans isomerase FKBP1A
UniProt Gene Name
FKBP1A
UniProt Synonym Gene Names
FKBP1; FKBP12; PPIase FKBP1A; 12 kDa FKBP; FKBP-12; FKBP-1A
UniProt Entry Name
FKB1A_HUMAN

NCBI Description

The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq, Sep 2008]

Uniprot Description

FKBP12: an immunophilin and peptidyl-prolyl cis-trans isomerase that binds to the immunosuppressant drugs FK506 (a.k.a. tacrolimus or Fujimycin) and rapamycin (a.k.a. Sirolimus). The FKBP12/rapamycin complex binds NFAT transcription factors and inhibits the induction of T cell genes including IL-2, IL-3, IL-4, TNF-alpha and GM-CSF. FK506 is used in treating patients after organ transplant and those suffering from autoimmune disorders. The immunosuppressant activity of FKBP12 is not apparently related to its prolyl isomerase activity. The FKBP12/rapamycin complex inhibits the mammalian target of rapamycin (mTOR) pathway by directly binding the mTOR Complex1 (mTORC1). mTORC1 contains Raptor, mLST8, and PRAS40, and interacts with DEPTOR, which inhibits its activity. mTOR, a S/T protein kinase, is a central regulator of cellular growth and metabolism. Its inhibition enhances the dependence on aerobic glycolysis in leukemic cells.

Protein type: EC 5.2.1.8; Isomerase

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum membrane; membrane; Z disc

Molecular Function: activin binding; calcium channel inhibitor activity; FK506 binding; peptidyl-prolyl cis-trans isomerase activity; protein binding; signal transducer activity; SMAD binding; transforming growth factor beta receptor binding

Biological Process: 'de novo' protein folding; fibril organization and biogenesis; heart morphogenesis; negative regulation of protein phosphatase type 2B activity; negative regulation of release of sequestered calcium ion into cytosol; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of protein binding; positive regulation of protein ubiquitination; protein maturation via protein folding; protein peptidyl-prolyl isomerization; protein refolding; regulation of activin receptor signaling pathway; regulation of immune response; regulation of protein localization; SMAD protein complex assembly; transforming growth factor beta receptor signaling pathway; ventricular cardiac muscle morphogenesis

Research Articles on FKBP1A

Similar Products

Product Notes

The FKBP1A fkbp1a (Catalog #AAA1278286) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGGCAGGC AACGCGCTGA GGGACTAGGC AGAGCCGTGG AACCGCCGCC AGGTCGCTGT TGGTCCACGC CGCCCGTCGC GCCGCCCGCC CGCTCAGCGT CCGCCGCCGC CATGGGAGTG CAGGTGGAAA CCATCTCCCC AGGAGACGGG CGCACCTTCC CCAAGCGCGG CCAGACCTGC GTGGTGCACT ACACCGGGAT GCTTGAAGAT GGAAAGAAAT TTGATTCCTC CCGGGACAGA AACAAGCCCT TTAAGTTTAT GCTAGGCAAG CAGGAGGTGA TCCGAGGCTG GGAAGAAGGG GTTGCCCAGA TGAGTGTGGG TCAGAGAGCC AAACTGACTA TATCTCCAGA TTATGCCTAT GGTGCCACTG GGCACCCAGG CATCATCCCA CCACATGCCA CTCTCGTCTT CGATGTGGAG CTTCTAAAAC TGGAATGA. It is sometimes possible for the material contained within the vial of "FKBP1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.