Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FHIT cdna clone

FHIT cDNA Clone

Gene Names
FHIT; FRA3B; AP3Aase
Synonyms
FHIT; FHIT cDNA Clone; FHIT cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgttcagatttggccaacatctcatcaagccctctgtagtgtttctcaaaacagaactgtccttcgctcttgtgaataggaaacctgtggtaccaggacatgtccttgtgtgcccgctgcggccagtggagcgcttccatgacctgcgtcctgatgaagtggccgatttgtttcagacgacccagagagtcgggacagtggtggaaaaacatttccatgggacctctctcaccttttccatgcaggatggccccgaagccggacagactgtgaagcacgttcacgtccatgttcttcccaggaaggctggagactttcacaggaatgacagcatctatgaggagctccagaaacatgacaaggaggactttcctgcctcttggagatcagaggaggaaatggcagcagaagccgcagctctgcgggtctactttcagtga
Sequence Length
444
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,858 Da
NCBI Official Full Name
Homo sapiens fragile histidine triad gene, mRNA
NCBI Official Synonym Full Names
fragile histidine triad
NCBI Official Symbol
FHIT
NCBI Official Synonym Symbols
FRA3B; AP3Aase
UniProt Protein Name
Bis(5'-adenosyl)-triphosphatase
UniProt Gene Name
FHIT
UniProt Synonym Gene Names
AP3Aase
UniProt Entry Name
FHIT_HUMAN

NCBI Description

This gene, a member of the histidine triad gene family, encodes a diadenosine 5',5'''-P1,P3-triphosphate hydrolase involved in purine metabolism. The gene encompasses the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts of this gene. In fact, aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]

Uniprot Description

FHIT: a member of the histidine triad gene family. A diadenosine 5',5'''-P1,P3-triphosphate hydrolase involved in purine metabolism. Its gene encompasses the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts of this gene. A possible tumor suppressor in specific tissues. Phospho-FHIT observed in liver and kidney, but not in brain and lung. Phospho-FHIT undetected in all tested human tumor cell lines. Aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas.

Protein type: Motility/polarity/chemotaxis; Nucleotide Metabolism - purine; EC 3.6.1.29; DNA replication; Hydrolase; Tumor suppressor

Chromosomal Location of Human Ortholog: 3p14.2

Cellular Component: cytoplasm; cytosol

Molecular Function: bis(5'-adenosyl)-triphosphatase activity; catalytic activity; hydrolase activity; identical protein binding; protein binding; ubiquitin protein ligase binding

Biological Process: negative regulation of proteasomal ubiquitin-dependent protein catabolic process; nucleotide metabolic process; purine nucleotide metabolic process

Similar Products

Product Notes

The FHIT fhit (Catalog #AAA1277255) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgttca gatttggcca acatctcatc aagccctctg tagtgtttct caaaacagaa ctgtccttcg ctcttgtgaa taggaaacct gtggtaccag gacatgtcct tgtgtgcccg ctgcggccag tggagcgctt ccatgacctg cgtcctgatg aagtggccga tttgtttcag acgacccaga gagtcgggac agtggtggaa aaacatttcc atgggacctc tctcaccttt tccatgcagg atggccccga agccggacag actgtgaagc acgttcacgt ccatgttctt cccaggaagg ctggagactt tcacaggaat gacagcatct atgaggagct ccagaaacat gacaaggagg actttcctgc ctcttggaga tcagaggagg aaatggcagc agaagccgca gctctgcggg tctactttca gtga. It is sometimes possible for the material contained within the vial of "FHIT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.