Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FEZF2 cdna clone

FEZF2 cDNA Clone

Gene Names
FEZF2; FEZ; TOF; FEZL; FKSG36; ZFP312; ZNF312
Synonyms
FEZF2; FEZF2 cDNA Clone; FEZF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaagctcggcttccctggagaccatggtgcccccggcctgcccgcgcgccggagcgtcgccggccacttccaagacactggccttttccatcgagcgcatcatggccaagacgtcggagccccgtgcgccctttgagccccggcctggagcgctagaggcggacggcagccagggcaagaaactgctcaacctctgctcgccgctgccctgtatgatccccctccagcccctaggctacgaggtgccgtcaaagacactgctcagttactcggagctctggaaaagcagcctccgggcgggcggcggcggaggcggcggcggcggtggcggcggcggcggcgggggggccccagtgtgcggcgccagcggcttgtgcaaaaccaactgtggcgtgtgctgcaaggccgagctgggcctggcgccgtccgcgctgcccgcgggcagggtcatcaagccgcaggtcatcaaccaggctgtggggctgacggccagcggctcgctctactacttcaactacctggactcgaccgcgtacccgccgtctgagctcctcagcggccacctcttcccgtctggcctcctcaatgcgcaggcccccgccgccctggctgctcaccccaagctctttctgctggagaacgccaagctggccggcctggctgcggacaagttcccccacccggctccctatccccataaggagcgcttgccggcgccgctggagcaggtactgaaggaaaactgggccctgactgccgagcgcggaggcgtcaagggccacagcaagctgccaggaggctccgcagatggcaagcccaaaaacttcacctgcgaggtgtgcggcaaggtgtttaacgctcactataatctcacccgccacatgccggtccacaccggagccagaccgttcgtgtgcaaagtctgcggcaaaggctttcgccaggccagcacgctctgcaggcacaaaattatccacacccaggaaaagccacataaatgcaaccagtgcggcaaagcgttcaaccgcagctccacgctcaacacgcatatccgcatccacgcgggctacaagcccttcgtctgcgaattttgcggcaaaggctttcaccaaaaagggaactacaagaaccacaagctgacccacagcggcgagaagcagtacaaatgtaccatctgcaacaaggccttccaccaggtctacaacctaaccttccatatgcacacccacaacgacaagaagcctttcacgtgcgccacttgcggcaaagggttttgcagaaactttgacttaaagaaacatgtgcgcaaactccacgacagcgtgggccctgctgccccctccgcaaaggacctgactaggacagtgcagagctga
Sequence Length
1380
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,326 Da
NCBI Official Full Name
Homo sapiens FEZ family zinc finger 2, mRNA
NCBI Official Synonym Full Names
FEZ family zinc finger 2
NCBI Official Symbol
FEZF2
NCBI Official Synonym Symbols
FEZ; TOF; FEZL; FKSG36; ZFP312; ZNF312
NCBI Protein Information
fez family zinc finger protein 2
UniProt Protein Name
Fez family zinc finger protein 2
UniProt Gene Name
FEZF2
UniProt Synonym Gene Names
FEZL; ZNF312
UniProt Entry Name
FEZF2_HUMAN

Uniprot Description

FEZF2: Transcription repressor. Required for the specification of corticospinal motor neurons and other subcerebral projection neurons. May play a role in layer and neuronal subtype-specific patterning of subcortical projections and axonal fasciculation. Controls the development of dendritic arborization and spines of large layer V pyramidal neurons. May be involved in innate immunity. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Cell development/differentiation; C2H2-type zinc finger protein; Transcription factor

Chromosomal Location of Human Ortholog: 3p14.2

Biological Process: axon guidance; negative regulation of transcription, DNA-dependent

Research Articles on FEZF2

Similar Products

Product Notes

The FEZF2 fezf2 (Catalog #AAA1278125) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaagct cggcttccct ggagaccatg gtgcccccgg cctgcccgcg cgccggagcg tcgccggcca cttccaagac actggccttt tccatcgagc gcatcatggc caagacgtcg gagccccgtg cgccctttga gccccggcct ggagcgctag aggcggacgg cagccagggc aagaaactgc tcaacctctg ctcgccgctg ccctgtatga tccccctcca gcccctaggc tacgaggtgc cgtcaaagac actgctcagt tactcggagc tctggaaaag cagcctccgg gcgggcggcg gcggaggcgg cggcggcggt ggcggcggcg gcggcggggg ggccccagtg tgcggcgcca gcggcttgtg caaaaccaac tgtggcgtgt gctgcaaggc cgagctgggc ctggcgccgt ccgcgctgcc cgcgggcagg gtcatcaagc cgcaggtcat caaccaggct gtggggctga cggccagcgg ctcgctctac tacttcaact acctggactc gaccgcgtac ccgccgtctg agctcctcag cggccacctc ttcccgtctg gcctcctcaa tgcgcaggcc cccgccgccc tggctgctca ccccaagctc tttctgctgg agaacgccaa gctggccggc ctggctgcgg acaagttccc ccacccggct ccctatcccc ataaggagcg cttgccggcg ccgctggagc aggtactgaa ggaaaactgg gccctgactg ccgagcgcgg aggcgtcaag ggccacagca agctgccagg aggctccgca gatggcaagc ccaaaaactt cacctgcgag gtgtgcggca aggtgtttaa cgctcactat aatctcaccc gccacatgcc ggtccacacc ggagccagac cgttcgtgtg caaagtctgc ggcaaaggct ttcgccaggc cagcacgctc tgcaggcaca aaattatcca cacccaggaa aagccacata aatgcaacca gtgcggcaaa gcgttcaacc gcagctccac gctcaacacg catatccgca tccacgcggg ctacaagccc ttcgtctgcg aattttgcgg caaaggcttt caccaaaaag ggaactacaa gaaccacaag ctgacccaca gcggcgagaa gcagtacaaa tgtaccatct gcaacaaggc cttccaccag gtctacaacc taaccttcca tatgcacacc cacaacgaca agaagccttt cacgtgcgcc acttgcggca aagggttttg cagaaacttt gacttaaaga aacatgtgcg caaactccac gacagcgtgg gccctgctgc cccctccgca aaggacctga ctaggacagt gcagagctga. It is sometimes possible for the material contained within the vial of "FEZF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.