Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FCHO2 cdna clone

FCHO2 cDNA Clone

Synonyms
FCHO2; FCHO2 cDNA Clone; FCHO2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtatttcgtcgagaatttttggggggaaaaaaatagtggctttgatgtcctctaccataatatgaaacatggacagatatcgacaaaagaactagcagattttgtaagggaacgagctaccatagaggaggcatactccaggtcaatgacaaaactagcaaaatctgcaagcaattattcacaacttggaacatttgcaccagtatgggatgtattcaaaacatctacagagaaattagcaaattgtcacttggatcttgttagaaaattacaagaattaataaaggaagttcagaagtatggagaagaacaagtaaagtctcataaaaagactaaagaagaagttgcaggaactctggaagctgtccaaaccattcagagcataactcaggccctccagaaatccaaggaaaattacaatgccaagtgtgtagaacaggagcgtttgaaaaaggaaggagctacacaaagagaaatagaaaaggcagctgttaaatctaagaaagctacagatacttataaactctatgtggaaaaatatgcattagcaaaagctgatttcgaacagaaaatgacagaaacagctcagaaatttcaagatattgaagaaactcatctcattcacataaaggaaattataggatccttgtcaaatgctataaaggaaattcatttgcagataggccaggtccatgaagaatttataaataacatggctaatactacagttgaaagtttgatacaaaaatttgctgagtcaaaaggcactgggaaggaaagacctggcctcattgaatttgaagaatgtgacactgctagtgcagttgaaggtataaaaccaaggaaaagaaagacctttgctttgccaggaatcattaaaaaggaaaaagatgcagaatctgtatggagtttcactgttgttgcccaggttggaatgcaatggcgcgatcttggcttactgcattctccacctcccaggttcaagcgattctcctcctacctcagcctcccaagtagctggaattacggcgcccaccaccacatctggctaattttttgtatttttagtagagacagggtttcaccatattggccaggctggtcgcgaactcctgacctcaggtga
Sequence Length
1131
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
85,146 Da
NCBI Official Full Name
Homo sapiens FCH domain only 2, mRNA
NCBI Official Synonym Full Names
FCH domain only 2
NCBI Official Symbol
FCHO2
NCBI Protein Information
F-BAR domain only protein 2
UniProt Protein Name
F-BAR domain only protein 2
Protein Family
UniProt Gene Name
FCHO2
UniProt Entry Name
FCHO2_HUMAN

Uniprot Description

FCHO2: a member of the Tubby-like proteins (TULPs) family, putative transcription factors which share similar 260 amino acid 'tubby domains' at their C-termini. Two alternatively spliced isoforms have been described.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 5q13.2

Cellular Component: clathrin-coated vesicle; coated pit; plasma membrane

Molecular Function: phosphatidylinositol-4,5-bisphosphate binding; phosphatidylserine binding; phosphoinositide binding; protein binding

Biological Process: clathrin cage assembly; membrane invagination

Research Articles on FCHO2

Similar Products

Product Notes

The FCHO2 fcho2 (Catalog #AAA1274352) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtatt tcgtcgagaa tttttggggg gaaaaaaata gtggctttga tgtcctctac cataatatga aacatggaca gatatcgaca aaagaactag cagattttgt aagggaacga gctaccatag aggaggcata ctccaggtca atgacaaaac tagcaaaatc tgcaagcaat tattcacaac ttggaacatt tgcaccagta tgggatgtat tcaaaacatc tacagagaaa ttagcaaatt gtcacttgga tcttgttaga aaattacaag aattaataaa ggaagttcag aagtatggag aagaacaagt aaagtctcat aaaaagacta aagaagaagt tgcaggaact ctggaagctg tccaaaccat tcagagcata actcaggccc tccagaaatc caaggaaaat tacaatgcca agtgtgtaga acaggagcgt ttgaaaaagg aaggagctac acaaagagaa atagaaaagg cagctgttaa atctaagaaa gctacagata cttataaact ctatgtggaa aaatatgcat tagcaaaagc tgatttcgaa cagaaaatga cagaaacagc tcagaaattt caagatattg aagaaactca tctcattcac ataaaggaaa ttataggatc cttgtcaaat gctataaagg aaattcattt gcagataggc caggtccatg aagaatttat aaataacatg gctaatacta cagttgaaag tttgatacaa aaatttgctg agtcaaaagg cactgggaag gaaagacctg gcctcattga atttgaagaa tgtgacactg ctagtgcagt tgaaggtata aaaccaagga aaagaaagac ctttgctttg ccaggaatca ttaaaaagga aaaagatgca gaatctgtat ggagtttcac tgttgttgcc caggttggaa tgcaatggcg cgatcttggc ttactgcatt ctccacctcc caggttcaag cgattctcct cctacctcag cctcccaagt agctggaatt acggcgccca ccaccacatc tggctaattt tttgtatttt tagtagagac agggtttcac catattggcc aggctggtcg cgaactcctg acctcaggtg a. It is sometimes possible for the material contained within the vial of "FCHO2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.