Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXW2 cdna clone

FBXW2 cDNA Clone

Gene Names
FBXW2; Md6; FBW2; Fwd2
Synonyms
FBXW2; FBXW2 cDNA Clone; FBXW2 cdna clone
Ordering
For Research Use Only!
Sequence
atggagagaaaggactttgagacatggcttgataacatttctgttacatttctttctctgacggacttgcagaaaaatgaaactctggatcacctgattagtctgagtggggcagtccagctcaggcatctctccaataacctagagactctcctcaagcgggacttcctcaaactccttcccctggagctcagtttttatttgttaaaatggctcgatcctcagactttactcacatgctgcctcgtctctaaacagtggaataaggtgataagtgcctgtacagaggtgtggcagactgcatgtaaaaatttgggctggcagatagatgattctgttcaggacgctttgcactggaagaaggtttatttgaaggctattttgagaatgaagcaactggaggaccatgaagcctttgaaacctcgtcattaattggacacagtgccagagtgtatgcactttactacaaagatggacttctctgtacagggtcagatgacttgtctgcaaagctgtgggatgtgagcacagggcagtgcgtttatggcatccagacccacacttgtgcagcggtgaagtttgatgaacagaagcttgtgacaggctcctttgacaacactgtggcttgctgggaatggagttccggagccaggacccagcactttcgggggcacacgggggcggtatttagcgtggactacaatgatgaactggatatcttggtgagcggctctgcagacttcactgtgaaagtatgggctttatctgctgggacatgcctgaacacactcaccgggcacacggaatgggtcaccaaggtagttttgcagaagtgcaaagtcaagtctctcttgcacagtcctggagactacatcctcttaagtgcagacaaatatgagattaagatttggccaattgggagagaaatcaactgtaagtgcttaaagacattgtctgtctctgaggatagaagtatctgcctgcagccaagacttcattttgatggcaaatacattgtctgtagttcagcacttggtctctaccagtgggactttgccagttatgatattctcagggtcatcaagactcctgagatagcaaacttggccttgcttggctttggagatatctttgccctgctgtttgacaaccgctacctgtacatcatggacttgcggacagagagcctgattagtcgctggcctctgccagagtacaggaaatcaaagagaggctcaagcttcctggcaggcgaagcatcctggctgaatggactggatgggcacaatgacacgggcttggtctttgccaccagcatgcctgaccacagtattcacctggtgttgtggaaggagcacggctga
Sequence Length
1365
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,466 Da
NCBI Official Full Name
Homo sapiens F-box and WD repeat domain containing 2, mRNA
NCBI Official Synonym Full Names
F-box and WD repeat domain containing 2
NCBI Official Symbol
FBXW2
NCBI Official Synonym Symbols
Md6; FBW2; Fwd2
NCBI Protein Information
F-box/WD repeat-containing protein 2
UniProt Protein Name
F-box/WD repeat-containing protein 2
UniProt Gene Name
FBXW2
UniProt Synonym Gene Names
FBW2; FWD2
UniProt Entry Name
FBXW2_HUMAN

NCBI Description

F-box proteins are an expanding family of eukaryotic proteins characterized by an approximately 40 amino acid motif, the F box. Some F-box proteins have been shown to be critical for the ubiquitin-mediated degradation of cellular regulatory proteins. In fact, F-box proteins are one of the four subunits of ubiquitin protein ligases, called SCFs. SCF ligases bring ubiquitin conjugating enzymes to substrates that are specifically recruited by the different F-box proteins. Mammalian F-box proteins are classified into three groups based on the presence of either WD-40 repeats, leucine-rich repeats, or the presence or absence of other protein-protein interacting domains. This gene encodes the second identified member of the F-box gene family and contains multiple WD-40 repeats. [provided by RefSeq, Jul 2008]

Uniprot Description

FBXW2: Substrate-recognition component of the SCF (SKP1-CUL1-F- box protein)-type E3 ubiquitin ligase complex. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 9q34

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: protein modification process; proteolysis

Research Articles on FBXW2

Similar Products

Product Notes

The FBXW2 fbxw2 (Catalog #AAA1276586) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagaa aggactttga gacatggctt gataacattt ctgttacatt tctttctctg acggacttgc agaaaaatga aactctggat cacctgatta gtctgagtgg ggcagtccag ctcaggcatc tctccaataa cctagagact ctcctcaagc gggacttcct caaactcctt cccctggagc tcagttttta tttgttaaaa tggctcgatc ctcagacttt actcacatgc tgcctcgtct ctaaacagtg gaataaggtg ataagtgcct gtacagaggt gtggcagact gcatgtaaaa atttgggctg gcagatagat gattctgttc aggacgcttt gcactggaag aaggtttatt tgaaggctat tttgagaatg aagcaactgg aggaccatga agcctttgaa acctcgtcat taattggaca cagtgccaga gtgtatgcac tttactacaa agatggactt ctctgtacag ggtcagatga cttgtctgca aagctgtggg atgtgagcac agggcagtgc gtttatggca tccagaccca cacttgtgca gcggtgaagt ttgatgaaca gaagcttgtg acaggctcct ttgacaacac tgtggcttgc tgggaatgga gttccggagc caggacccag cactttcggg ggcacacggg ggcggtattt agcgtggact acaatgatga actggatatc ttggtgagcg gctctgcaga cttcactgtg aaagtatggg ctttatctgc tgggacatgc ctgaacacac tcaccgggca cacggaatgg gtcaccaagg tagttttgca gaagtgcaaa gtcaagtctc tcttgcacag tcctggagac tacatcctct taagtgcaga caaatatgag attaagattt ggccaattgg gagagaaatc aactgtaagt gcttaaagac attgtctgtc tctgaggata gaagtatctg cctgcagcca agacttcatt ttgatggcaa atacattgtc tgtagttcag cacttggtct ctaccagtgg gactttgcca gttatgatat tctcagggtc atcaagactc ctgagatagc aaacttggcc ttgcttggct ttggagatat ctttgccctg ctgtttgaca accgctacct gtacatcatg gacttgcgga cagagagcct gattagtcgc tggcctctgc cagagtacag gaaatcaaag agaggctcaa gcttcctggc aggcgaagca tcctggctga atggactgga tgggcacaat gacacgggct tggtctttgc caccagcatg cctgaccaca gtattcacct ggtgttgtgg aaggagcacg gctga. It is sometimes possible for the material contained within the vial of "FBXW2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.