Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXO9 cdna clone

FBXO9 cDNA Clone

Gene Names
FBXO9; FBX9; VCIA1; NY-REN-57; dJ341E18.2
Synonyms
FBXO9; FBXO9 cDNA Clone; FBXO9 cdna clone
Ordering
For Research Use Only!
Sequence
atgttccgagctcagtggatgtttgaacttgctccaggtgtaagctctagcaatttagaaaatcgaccttgcagagcagcaagaggctctctccagaaaacatcggcagataccaaaggaaaacaagaacaggcaaaagaagaaaaggctcgagaactcttcctaaaagcagtagaagaagaacaaaatggagctctctatgaagccatcaagttttatcgtagggctatgcaacttgtacctgatatagagttcaagattacttatacccggtctccagatggtgatggcgttggaaacagctacattgaagataatgatgatgacagcaaaatggcagatctcttgtcctacttccagcagcaactcacatttcaggagtctgtgcttaaactgtgtcagcctgagcttgagagcagtcagattcacatatcagtgctgccaatggaggtcctgatgtacatcttccgatgggtggtgtctagtgacttggacctcagatcattggagcagttgtcgctggtgtgcagaggattctacatctgtgccagagaccctgaaatatggcgtctggcctgcttgaaagtttggggcagaagctgtattaaacttgttccgtacacgtcctggagagagatgtttttagaacggcctcgtgttcggtttgatggcgtgtatatcagtaaaaccacatatattcgtcaaggggaacagtctcttgatggtttctatagagcctggcaccaagtggaatattacaggtacataagattctttcctgatggccatgtgatgatgttgacaacccctgaagagcctcagtccattgttccacgtttaagaactaggaataccaggactgatgcaattctactgggtcactatcgcttgtcacaagacacagacaatcagaccaaagtatttgctgtaataactaagaaaaaagaagaaaaaccacttgactataaatacagatattttcgtcgtgtccctgtacaagaagcagatcagagttttcatgtggggctacagctatgttccagtggtcaccagaggttcaacaaactcatctggatacatcattcttgtcacattacttacaaatcaactggtgagactgcagtcagtgcttttgagattgacaagatgtacacccccttgttcttcgccagagtaaggagctacacagctttctcagaaaggcctctgtag
Sequence Length
1212
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,361 Da
NCBI Official Full Name
Homo sapiens F-box protein 9, mRNA
NCBI Official Synonym Full Names
F-box protein 9
NCBI Official Symbol
FBXO9
NCBI Official Synonym Symbols
FBX9; VCIA1; NY-REN-57; dJ341E18.2
NCBI Protein Information
F-box only protein 9
UniProt Protein Name
F-box only protein 9
Protein Family
UniProt Gene Name
FBXO9
UniProt Synonym Gene Names
FBX9; VCIA1
UniProt Entry Name
FBX9_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates at least 3 transcript variants diverging at the 5' terminus. [provided by RefSeq, Jul 2008]

Uniprot Description

FBXO9: Substrate-recognition component of the SCF (SKP1-CUL1-F- box protein)-type E3 ubiquitin ligase complex. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 6p12.3-p11.2

Cellular Component: cytoplasm; SCF ubiquitin ligase complex

Molecular Function: protein binding

Biological Process: protein ubiquitination; regulation of TOR signaling pathway; SCF-dependent proteasomal ubiquitin-dependent protein catabolic process

Research Articles on FBXO9

Similar Products

Product Notes

The FBXO9 fbxo9 (Catalog #AAA1273707) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccgag ctcagtggat gtttgaactt gctccaggtg taagctctag caatttagaa aatcgacctt gcagagcagc aagaggctct ctccagaaaa catcggcaga taccaaagga aaacaagaac aggcaaaaga agaaaaggct cgagaactct tcctaaaagc agtagaagaa gaacaaaatg gagctctcta tgaagccatc aagttttatc gtagggctat gcaacttgta cctgatatag agttcaagat tacttatacc cggtctccag atggtgatgg cgttggaaac agctacattg aagataatga tgatgacagc aaaatggcag atctcttgtc ctacttccag cagcaactca catttcagga gtctgtgctt aaactgtgtc agcctgagct tgagagcagt cagattcaca tatcagtgct gccaatggag gtcctgatgt acatcttccg atgggtggtg tctagtgact tggacctcag atcattggag cagttgtcgc tggtgtgcag aggattctac atctgtgcca gagaccctga aatatggcgt ctggcctgct tgaaagtttg gggcagaagc tgtattaaac ttgttccgta cacgtcctgg agagagatgt ttttagaacg gcctcgtgtt cggtttgatg gcgtgtatat cagtaaaacc acatatattc gtcaagggga acagtctctt gatggtttct atagagcctg gcaccaagtg gaatattaca ggtacataag attctttcct gatggccatg tgatgatgtt gacaacccct gaagagcctc agtccattgt tccacgttta agaactagga ataccaggac tgatgcaatt ctactgggtc actatcgctt gtcacaagac acagacaatc agaccaaagt atttgctgta ataactaaga aaaaagaaga aaaaccactt gactataaat acagatattt tcgtcgtgtc cctgtacaag aagcagatca gagttttcat gtggggctac agctatgttc cagtggtcac cagaggttca acaaactcat ctggatacat cattcttgtc acattactta caaatcaact ggtgagactg cagtcagtgc ttttgagatt gacaagatgt acaccccctt gttcttcgcc agagtaagga gctacacagc tttctcagaa aggcctctgt ag. It is sometimes possible for the material contained within the vial of "FBXO9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.