Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXO18 cdna clone

FBXO18 cDNA Clone

Gene Names
FBXO18; FBH1; Fbx18; hFBH1
Synonyms
FBXO18; FBXO18 cDNA Clone; FBXO18 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgaagagcaagctgtcagcaaagtggacggcatcctgtctaactgtggcatagaaaaggagtcagacctgtgtgtgctgaacctcatacgatacacagccaccactaagtgctctccgagtgtggatcccgagagggtgctgtggagtctgagggaccaccccctcctccccgaggctgaggcgtgtgtgcggcaacacctccccgacctctacgctgctgccgggggtgtcaacatctgggccctggtggcggctgtggtgctcctctccagcagtgtgaatgacatccagcgactgctcttctgcctccggagacccagctccacggtgaccatgccagatgtcaccgagaccctgtactgcatagccgtgcttctctacgccatgagggagaaggggattaacatcagcaataggattcactacaacattttctattgcctatatcttcaggagaattcctgcactcaggccacaaaagttaaagaggagccatctgtctggccaggcaagaaaaccatccaacttacacatgaacaacagctgattctgaatcacaagatggaacctctccaggtggtgaaaattatggcctttgccggcactgggaagacctcaacgctggtcaagtatgcagagaagtggtctcagagcaggtttctgtatgtgacattcaacaagagcatcgcaaagcaggccgaacgcgtcttccccagcaacgtcatctgcaaaaccttccactccatggcctacgggcacatagggcggaagtaccagtcaaagaagaagttgaatctcttcaagttaacacccttcatggtcaactccgtccttgctgaagggaagggtggattcataagagccaagcttgtgtgtaagactctagaaaacttctttgcctcggctgacgaagagctgaccattgatcacgtgcctatttggtgtaagaacagccaaggacagagagtcatggttgagcagagtgaaaaactgaatggtgtccttgaagcgagccgcctctgggataacatgcggaagctgggggagtgcacagaagaggcgcaccagatgactcatgacggctacttgaaactctggcagctgagcaagccttcgctggcctcttttgacgccatctttgtggatgaggcccaggactgcacaccagctatcatgaacatagttctgtctcagccatgtgggaaaatctttgtaggggacccgcaccagcagatctataccttccggggtgcggtcaacgccctgttcacagtgccccacacccacgtcttctatctcacgcagagttttcggtttggtgtggaaatagcttatgtgggagctactatcttggatgtttgcaagagagtcaggaaaaagactttggttggaggaaaccatcagagtggcattagaggtgacgcaaaggggcaagtggccttgttgtcccggaccaacgccaacgtgtttgatgaggccgtacgggtgacggaaggggaattcccttcaaggatacatttgattggggggattaaatcatttggattggacagaatcattgatatttggatccttcttcagccagaggaagaacggaggaaacaaaacctcgtcattaaagacaaatttatcagaagatgggtgcacaaagaaggctttagtggcttcaagaggtatgtgaccgctgccgaggacaaggagcttgaagccaagatcgcagttgttgaaaagtataacatcaggattccagagctggtgcaaaggatagaaaaatgccatatagaagatttggactttgcagagtacattctgggcactgtgcacaaagccaaaggcctggagtttgacactgtgcatgttttggatgattttgtgaaagtgccttgtgcccggcataacctgccccagcttccgcacttcagagttgagtcattttctgaggatgaatggaatttactgtatgttgcagtaactcgagccaagaagcgtctcatcatgaccaaatcattggaaaacattttgactttggctggggagtacttcttgcaagcagagctgacaagcaacgtcttaaaaacaggcgtggtgcgctgctgcgtgggacagtgcaacaatgccatccctgttgacaccgtccttaccatgaagaagctgcccatcacctatagcaacaggaaggaaaacaaggggggctacctctgccactcctgtgcggagcagcgcatcgggcccctggcgttcctgacagcctccccggagcaggtgcgcgccatggagcgcactgtggagaacatcgtactgccccggcatgaggccctgctcttcctcgtcttctga
Sequence Length
2343
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
123,375 Da
NCBI Official Full Name
Homo sapiens F-box protein, helicase, 18, mRNA
NCBI Official Synonym Full Names
F-box protein, helicase, 18
NCBI Official Symbol
FBXO18
NCBI Official Synonym Symbols
FBH1; Fbx18; hFBH1
NCBI Protein Information
F-box DNA helicase 1
UniProt Protein Name
F-box DNA helicase 1
Protein Family
UniProt Gene Name
FBXO18
UniProt Synonym Gene Names
hFBH1
UniProt Entry Name
FBH1_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

FBXO18: DNA-dependent ATPase. Unwinds double-stranded DNA in a 3' to 5' direction. Belongs to the helicase family. UvrD subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.4.12; Helicase

Chromosomal Location of Human Ortholog: 10p15.1

Cellular Component: chromatin; nucleus; SCF ubiquitin ligase complex

Molecular Function: 3'-5' DNA helicase activity; DNA helicase activity; DNA translocase activity; double-stranded DNA binding; protein binding; single-stranded DNA binding

Biological Process: cell death; DNA catabolic process, endonucleolytic; double-strand break repair via homologous recombination; positive regulation of protein amino acid phosphorylation; protein ubiquitination; replication fork processing; replication fork protection; response to DNA damage stimulus

Research Articles on FBXO18

Similar Products

Product Notes

The FBXO18 fbxo18 (Catalog #AAA1268652) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgaag agcaagctgt cagcaaagtg gacggcatcc tgtctaactg tggcatagaa aaggagtcag acctgtgtgt gctgaacctc atacgataca cagccaccac taagtgctct ccgagtgtgg atcccgagag ggtgctgtgg agtctgaggg accaccccct cctccccgag gctgaggcgt gtgtgcggca acacctcccc gacctctacg ctgctgccgg gggtgtcaac atctgggccc tggtggcggc tgtggtgctc ctctccagca gtgtgaatga catccagcga ctgctcttct gcctccggag acccagctcc acggtgacca tgccagatgt caccgagacc ctgtactgca tagccgtgct tctctacgcc atgagggaga aggggattaa catcagcaat aggattcact acaacatttt ctattgccta tatcttcagg agaattcctg cactcaggcc acaaaagtta aagaggagcc atctgtctgg ccaggcaaga aaaccatcca acttacacat gaacaacagc tgattctgaa tcacaagatg gaacctctcc aggtggtgaa aattatggcc tttgccggca ctgggaagac ctcaacgctg gtcaagtatg cagagaagtg gtctcagagc aggtttctgt atgtgacatt caacaagagc atcgcaaagc aggccgaacg cgtcttcccc agcaacgtca tctgcaaaac cttccactcc atggcctacg ggcacatagg gcggaagtac cagtcaaaga agaagttgaa tctcttcaag ttaacaccct tcatggtcaa ctccgtcctt gctgaaggga agggtggatt cataagagcc aagcttgtgt gtaagactct agaaaacttc tttgcctcgg ctgacgaaga gctgaccatt gatcacgtgc ctatttggtg taagaacagc caaggacaga gagtcatggt tgagcagagt gaaaaactga atggtgtcct tgaagcgagc cgcctctggg ataacatgcg gaagctgggg gagtgcacag aagaggcgca ccagatgact catgacggct acttgaaact ctggcagctg agcaagcctt cgctggcctc ttttgacgcc atctttgtgg atgaggccca ggactgcaca ccagctatca tgaacatagt tctgtctcag ccatgtggga aaatctttgt aggggacccg caccagcaga tctatacctt ccggggtgcg gtcaacgccc tgttcacagt gccccacacc cacgtcttct atctcacgca gagttttcgg tttggtgtgg aaatagctta tgtgggagct actatcttgg atgtttgcaa gagagtcagg aaaaagactt tggttggagg aaaccatcag agtggcatta gaggtgacgc aaaggggcaa gtggccttgt tgtcccggac caacgccaac gtgtttgatg aggccgtacg ggtgacggaa ggggaattcc cttcaaggat acatttgatt ggggggatta aatcatttgg attggacaga atcattgata tttggatcct tcttcagcca gaggaagaac ggaggaaaca aaacctcgtc attaaagaca aatttatcag aagatgggtg cacaaagaag gctttagtgg cttcaagagg tatgtgaccg ctgccgagga caaggagctt gaagccaaga tcgcagttgt tgaaaagtat aacatcagga ttccagagct ggtgcaaagg atagaaaaat gccatataga agatttggac tttgcagagt acattctggg cactgtgcac aaagccaaag gcctggagtt tgacactgtg catgttttgg atgattttgt gaaagtgcct tgtgcccggc ataacctgcc ccagcttccg cacttcagag ttgagtcatt ttctgaggat gaatggaatt tactgtatgt tgcagtaact cgagccaaga agcgtctcat catgaccaaa tcattggaaa acattttgac tttggctggg gagtacttct tgcaagcaga gctgacaagc aacgtcttaa aaacaggcgt ggtgcgctgc tgcgtgggac agtgcaacaa tgccatccct gttgacaccg tccttaccat gaagaagctg cccatcacct atagcaacag gaaggaaaac aaggggggct acctctgcca ctcctgtgcg gagcagcgca tcgggcccct ggcgttcctg acagcctccc cggagcaggt gcgcgccatg gagcgcactg tggagaacat cgtactgccc cggcatgagg ccctgctctt cctcgtcttc tga. It is sometimes possible for the material contained within the vial of "FBXO18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.