Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXO11 cdna clone

FBXO11 cDNA Clone

Gene Names
FBXO11; UBR6; VIT1; FBX11; PRMT9; UG063H01
Synonyms
FBXO11; FBXO11 cDNA Clone; FBXO11 cdna clone
Ordering
For Research Use Only!
Sequence
atggttgcagaagaatcaggtcctggtgcacaaaatagtccataccaacttcgtagaaaaactcttttgccgaaaagaacagcgtgtcccacaaagaacagtatggagggcgcctcaacttcaactacagaaaactttggtcatcgtgcaaaacgtgcaagagtgtctggaaaatcacaagatctatcagcagcacctgctgaacagtatcttcaggagaaactgccagatgaagtggttctaaaaatcttctcttacttgctggaacaggatctttgtagagcagcttgtgtatgtaaacgcttcagtgaacttgctaatgatccaattttgtggaaacgattatatatggaagtatttgaatatactcgccctatgatgcatcctgaacctggaaaattctaccagattaatccagaagagtatgaacatccaaatccctggaaagagagtttccagcagttgtataaaggtgcacatgtaaagccaggatttgctgaacatttctacagtaaccctgcaagatataaaggaagagaaaatatgttgtattatgatactattgaagatgcccttggtggggtacaagaggctcattttgatggacttatctttgttcattctggaatatatactgatgaatggatatatattgaatctccaatcaccatgattggtgcagcacctgggaaagtggcagacaaagttataattgaaaacactagagattcaaccttcgtttttatggaaggctctgaagatgcttatgttggatatatgacaataaggtttaaccctgatgacaaatctgcacaacaccacaatgcacaccactgcttagagattacagtaaattgtagccctattattgatcactgtatcatccgaagtacatgtacagttggttctgcagtatgtgttagtggtcaaggagcatgtcccaccatcaagcactgtaacatcagtgactgtgaaaatgttggactatatataacagatcatgcacagggaatatatgaggataatgaaatttccaataatgcgttagctgggatttgggttaaaaatcatggaaacccaattattagacggaatcatattcatcatggacgtgatgttggtgtgttcacatttgatcatggcatgggttactttgaaagttgcaatatacacagaaataggatagcaggctttgaagtaaaagcctatgctaaccctacagtggttcgatgtgaaattcaccatgggcagactggaggaatatatgtccatgaaaaaggaagaggacaattcatagagaataaaatctatgcaaacaactttgcaggtgtatggattacctcaaatagtgacccaacaataaggggaaattctatatttaatggaaatcaaggaggagtttacatctttggtgatggacgaggccttattgaaggaaatgacatttatggcaatgcattagcaggaattcaaattaggacaaacagttgtccaattgttcggcataacaaaattcatgatggccagcatggtgggatttatgtgcatgaaaagggacaaggagtaatagaagagaatgaagtttatagtaacactctagctggagtctgggtgacaactggcagcactccagtactgagaagaaaccggatacacagtggcaagcaggttggtgtttatttttatgacaatggacatggagtgctagaagacaatgatatctataatcatatgtattcaggggttcagataaggactggaagcaaccccaaaattagacgcaacaaaatctggggaggacagaatggtggaattctagtttataattctggtctaggctgtatagaagacaatgaaatatttgacaatgcaatggctggagtctggattaagacagatagtaatcctacactaagaagaaataaaatccatgatggaagagatggtggcatctgtatatttaatgggggtcgaggtctccttgaagaaaatgatattttcaggaatgctcaagcaggtgttctcatcagcactaatagtcatccaatcttaaggaaaaacagaatatttgatggatttgccgcaggtattgaaattacaaatcacgcaactgcaacactagaaggcaatcagatttttaacaaccggtttggaggcttatttttagcatctggtgttaatgtgacaatgaaagataacaaaataatgaacaatcaagatgccatagaaaaggctgttagtagaggccaatgtttatataaaatatcaagttataccagctatcccatgcatgatttctacagatgtcatacttgtaacaccacagatcgaaatgccatatgtgtgaactgcattaagaagtgccatcagggacatgatgtagagtttattagacatgataggtttttctgtgactgtggtgctggaacactgtctaatccttgtacattagctggtgagcctacacatgatacagatacactatatgactctgctccacctatagaatctaatacattgcagcacaactga
Sequence Length
2532
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
106,864 Da
NCBI Official Full Name
Homo sapiens F-box protein 11, mRNA
NCBI Official Synonym Full Names
F-box protein 11
NCBI Official Symbol
FBXO11
NCBI Official Synonym Symbols
UBR6; VIT1; FBX11; PRMT9; UG063H01
NCBI Protein Information
F-box only protein 11
UniProt Protein Name
F-box only protein 11
Protein Family
UniProt Gene Name
FBXO11
UniProt Synonym Gene Names
FBX11; PRMT9; VIT1; VIT-1
UniProt Entry Name
FBX11_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

Uniprot Description

PRMT9: Substrate recognition component of the a (SKP1-CUL1-F- box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Probably recognizes and binds to phosphorylated target proteins. Binds to and neddylates phosphorylated p53/TP53, inhibiting its transcriptional activity. SCF(FBXO11) does not seem to direct ubiquitination of TP53. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 2p16.3

Cellular Component: cytoplasm; nucleolus; nucleus

Molecular Function: protein binding; protein-arginine N-methyltransferase activity

Biological Process: protein modification process

Research Articles on FBXO11

Similar Products

Product Notes

The FBXO11 fbxo11 (Catalog #AAA1266018) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttgcag aagaatcagg tcctggtgca caaaatagtc cataccaact tcgtagaaaa actcttttgc cgaaaagaac agcgtgtccc acaaagaaca gtatggaggg cgcctcaact tcaactacag aaaactttgg tcatcgtgca aaacgtgcaa gagtgtctgg aaaatcacaa gatctatcag cagcacctgc tgaacagtat cttcaggaga aactgccaga tgaagtggtt ctaaaaatct tctcttactt gctggaacag gatctttgta gagcagcttg tgtatgtaaa cgcttcagtg aacttgctaa tgatccaatt ttgtggaaac gattatatat ggaagtattt gaatatactc gccctatgat gcatcctgaa cctggaaaat tctaccagat taatccagaa gagtatgaac atccaaatcc ctggaaagag agtttccagc agttgtataa aggtgcacat gtaaagccag gatttgctga acatttctac agtaaccctg caagatataa aggaagagaa aatatgttgt attatgatac tattgaagat gcccttggtg gggtacaaga ggctcatttt gatggactta tctttgttca ttctggaata tatactgatg aatggatata tattgaatct ccaatcacca tgattggtgc agcacctggg aaagtggcag acaaagttat aattgaaaac actagagatt caaccttcgt ttttatggaa ggctctgaag atgcttatgt tggatatatg acaataaggt ttaaccctga tgacaaatct gcacaacacc acaatgcaca ccactgctta gagattacag taaattgtag ccctattatt gatcactgta tcatccgaag tacatgtaca gttggttctg cagtatgtgt tagtggtcaa ggagcatgtc ccaccatcaa gcactgtaac atcagtgact gtgaaaatgt tggactatat ataacagatc atgcacaggg aatatatgag gataatgaaa tttccaataa tgcgttagct gggatttggg ttaaaaatca tggaaaccca attattagac ggaatcatat tcatcatgga cgtgatgttg gtgtgttcac atttgatcat ggcatgggtt actttgaaag ttgcaatata cacagaaata ggatagcagg ctttgaagta aaagcctatg ctaaccctac agtggttcga tgtgaaattc accatgggca gactggagga atatatgtcc atgaaaaagg aagaggacaa ttcatagaga ataaaatcta tgcaaacaac tttgcaggtg tatggattac ctcaaatagt gacccaacaa taaggggaaa ttctatattt aatggaaatc aaggaggagt ttacatcttt ggtgatggac gaggccttat tgaaggaaat gacatttatg gcaatgcatt agcaggaatt caaattagga caaacagttg tccaattgtt cggcataaca aaattcatga tggccagcat ggtgggattt atgtgcatga aaagggacaa ggagtaatag aagagaatga agtttatagt aacactctag ctggagtctg ggtgacaact ggcagcactc cagtactgag aagaaaccgg atacacagtg gcaagcaggt tggtgtttat ttttatgaca atggacatgg agtgctagaa gacaatgata tctataatca tatgtattca ggggttcaga taaggactgg aagcaacccc aaaattagac gcaacaaaat ctggggagga cagaatggtg gaattctagt ttataattct ggtctaggct gtatagaaga caatgaaata tttgacaatg caatggctgg agtctggatt aagacagata gtaatcctac actaagaaga aataaaatcc atgatggaag agatggtggc atctgtatat ttaatggggg tcgaggtctc cttgaagaaa atgatatttt caggaatgct caagcaggtg ttctcatcag cactaatagt catccaatct taaggaaaaa cagaatattt gatggatttg ccgcaggtat tgaaattaca aatcacgcaa ctgcaacact agaaggcaat cagattttta acaaccggtt tggaggctta tttttagcat ctggtgttaa tgtgacaatg aaagataaca aaataatgaa caatcaagat gccatagaaa aggctgttag tagaggccaa tgtttatata aaatatcaag ttataccagc tatcccatgc atgatttcta cagatgtcat acttgtaaca ccacagatcg aaatgccata tgtgtgaact gcattaagaa gtgccatcag ggacatgatg tagagtttat tagacatgat aggtttttct gtgactgtgg tgctggaaca ctgtctaatc cttgtacatt agctggtgag cctacacatg atacagatac actatatgac tctgctccac ctatagaatc taatacattg cagcacaact ga. It is sometimes possible for the material contained within the vial of "FBXO11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.