Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXL5 cdna clone

FBXL5 cDNA Clone

Gene Names
FBXL5; FBL4; FBL5; FLR1
Synonyms
FBXL5; FBXL5 cDNA Clone; FBXL5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccctttcctgaagaagtggacgtcttcaccgccccacactggcggatgaagcagctggtggggctctactgcgacaagctttctaaaaccaatttttccaacaacaacgatttccgtgctcttctgcagtctttgtatgctactttcacggagttcaaaatgcatgagcagattgaaaatgaatacattattggtttgcttcaacaacgcagccagaccatttataatgtacattctgacaataaactctccgagatgcttagcctctttgaaaagggactgaagaatgttaagaatgaatatgaacagttaaattatgcaaaacaactgaaagagagattggaggcttttacaagagattttcttcctcacatgaaagaggaagaggaggtttttcagcccatgttaatggaatattttacctatgaagagcttaaggatattaaaaagaaagtgattgcacaacactgctctcagaaggatactgcagaactccttagaggtcttagcctatggaatcatgctgaagagcgacagaagttttttaaatattccgtggatgaaaagtcagataaagaagcagaagtgtcagaacactccacaggtataacccatcttcctcctgaggtaatgctgtcaattttcagctatcttaatcctcaagagttatgtcgatgcagtcaagtaagcatgaaatggtctcagctgacaaaaacgagatcgctttggaaacatctttaccctgttcattgggccagaggtgactggtatagtggtcccgcaactgaacttgatactgaacctgatgatgaatgggtgaaaaataggaaagatgaaagtcgtgcttttcatgagtgggatgaagatgctgacattgatgaatctgaagagtctgcggaggaatcaattgctatcagcattgcacaaatggaaaaacgtttactccatggcttaattcataacgttctaccatatgttggtacttctgtaaaaaccttagtattagcatacagctctgcagtttccagcaaaatggttaggcagattttagagctttgtcctaacctggagcatctggatcttacccagactgacatttcagattctgcatttgacagttggtcttggcttggttgctgccagagtcttcggcatcttgatctgtctggttgtgagaaaatcacagatgtggccctagagaagatttccagagctcttggaattctgacatctcatcaaagtggctttttgaaaacatctacaagcaaaattacttcaactgcgtggaaaaataaagacattaccatgcagtccaccaagcagtatgcctgtttgcacgatttaactaacaagggcattggagaagaaatagataatgaacacccctggactaagcctgtttcttctgagaatttcacttctccttatgtgtggatgttagatgctgaagatttggctgatattgaagatactgtggaatggagacatagaaatgttgaaagtctttgtgtaatggaaacagcatccaactttagttgttccacctctggttgttttagtaaggacattgttggactaaggactagtgtctgttggcagcagcattgtgcttctccagcctttgcgtattgtggtcactcattttgttgtacaggaacagctttaagaactatgtcatcactcccagaatcttctgcaatgtgtagaaaagcagcaaggactagattgcctaggggaaaagacttaatttactttgggagtgaaaaatctgatcaagagactggacgtgtacttctgtttctcagtttatctggatgttatcagatcacagaccatggtctcagggttttgactctgggaggagggctgccttatttggagcaccttaatctctctggttgtcttactataactggtgcaggcctgcaggatttggtttcagcatgtccttctctgaatgatgaatacttttactactgtgacaacattaacggtcctcatgctgataccgccagtggatgccagaatttgcagtgtggttttcgagcctgctgccgctctggcgaatga
Sequence Length
2076
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,590 Da
NCBI Official Full Name
Homo sapiens F-box and leucine-rich repeat protein 5, mRNA
NCBI Official Synonym Full Names
F-box and leucine rich repeat protein 5
NCBI Official Symbol
FBXL5
NCBI Official Synonym Symbols
FBL4; FBL5; FLR1
NCBI Protein Information
F-box/LRR-repeat protein 5
UniProt Protein Name
F-box/LRR-repeat protein 5
Protein Family
UniProt Gene Name
FBXL5
UniProt Synonym Gene Names
FBL4; FBL5; FLR1
UniProt Entry Name
FBXL5_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2010]

Uniprot Description

FBXL5: Component of some SCF (SKP1-cullin-F-box) protein ligase complex that plays a central role in iron homeostasis by promoting the ubiquitination and subsequent degradation of IREB2/IRP2. Upon high iron and oxygen level, it specifically recognizes and binds IREB2/IRP2, promoting its ubiquitination and degradation by the proteasome. Promotes ubiquitination and subsequent degradation of DCTN1/p150-glued. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 4p15.32

Cellular Component: perinuclear region of cytoplasm; SCF ubiquitin ligase complex

Molecular Function: iron ion binding; protein binding

Biological Process: iron ion homeostasis; protein ubiquitination; SCF-dependent proteasomal ubiquitin-dependent protein catabolic process

Research Articles on FBXL5

Similar Products

Product Notes

The FBXL5 fbxl5 (Catalog #AAA1268358) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccct ttcctgaaga agtggacgtc ttcaccgccc cacactggcg gatgaagcag ctggtggggc tctactgcga caagctttct aaaaccaatt tttccaacaa caacgatttc cgtgctcttc tgcagtcttt gtatgctact ttcacggagt tcaaaatgca tgagcagatt gaaaatgaat acattattgg tttgcttcaa caacgcagcc agaccattta taatgtacat tctgacaata aactctccga gatgcttagc ctctttgaaa agggactgaa gaatgttaag aatgaatatg aacagttaaa ttatgcaaaa caactgaaag agagattgga ggcttttaca agagattttc ttcctcacat gaaagaggaa gaggaggttt ttcagcccat gttaatggaa tattttacct atgaagagct taaggatatt aaaaagaaag tgattgcaca acactgctct cagaaggata ctgcagaact ccttagaggt cttagcctat ggaatcatgc tgaagagcga cagaagtttt ttaaatattc cgtggatgaa aagtcagata aagaagcaga agtgtcagaa cactccacag gtataaccca tcttcctcct gaggtaatgc tgtcaatttt cagctatctt aatcctcaag agttatgtcg atgcagtcaa gtaagcatga aatggtctca gctgacaaaa acgagatcgc tttggaaaca tctttaccct gttcattggg ccagaggtga ctggtatagt ggtcccgcaa ctgaacttga tactgaacct gatgatgaat gggtgaaaaa taggaaagat gaaagtcgtg cttttcatga gtgggatgaa gatgctgaca ttgatgaatc tgaagagtct gcggaggaat caattgctat cagcattgca caaatggaaa aacgtttact ccatggctta attcataacg ttctaccata tgttggtact tctgtaaaaa ccttagtatt agcatacagc tctgcagttt ccagcaaaat ggttaggcag attttagagc tttgtcctaa cctggagcat ctggatctta cccagactga catttcagat tctgcatttg acagttggtc ttggcttggt tgctgccaga gtcttcggca tcttgatctg tctggttgtg agaaaatcac agatgtggcc ctagagaaga tttccagagc tcttggaatt ctgacatctc atcaaagtgg ctttttgaaa acatctacaa gcaaaattac ttcaactgcg tggaaaaata aagacattac catgcagtcc accaagcagt atgcctgttt gcacgattta actaacaagg gcattggaga agaaatagat aatgaacacc cctggactaa gcctgtttct tctgagaatt tcacttctcc ttatgtgtgg atgttagatg ctgaagattt ggctgatatt gaagatactg tggaatggag acatagaaat gttgaaagtc tttgtgtaat ggaaacagca tccaacttta gttgttccac ctctggttgt tttagtaagg acattgttgg actaaggact agtgtctgtt ggcagcagca ttgtgcttct ccagcctttg cgtattgtgg tcactcattt tgttgtacag gaacagcttt aagaactatg tcatcactcc cagaatcttc tgcaatgtgt agaaaagcag caaggactag attgcctagg ggaaaagact taatttactt tgggagtgaa aaatctgatc aagagactgg acgtgtactt ctgtttctca gtttatctgg atgttatcag atcacagacc atggtctcag ggttttgact ctgggaggag ggctgcctta tttggagcac cttaatctct ctggttgtct tactataact ggtgcaggcc tgcaggattt ggtttcagca tgtccttctc tgaatgatga atacttttac tactgtgaca acattaacgg tcctcatgct gataccgcca gtggatgcca gaatttgcag tgtggttttc gagcctgctg ccgctctggc gaatga. It is sometimes possible for the material contained within the vial of "FBXL5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.