Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXL21 cdna clone

FBXL21 cDNA Clone

Gene Names
FBXL21; FBL3B; Fbl21; FBXL3B; FBXL3P
Synonyms
FBXL21; FBXL21 cDNA Clone; FBXL21 cdna clone
Ordering
For Research Use Only!
Sequence
ATGCACTTCTTTCTATATGAAGAGGAATTCGAGACGTTCTTCAAAGAAGAAACCCCTGTTACTCACCTTTATTTTGGTCGTTCAGTCAGCAAAGTGGTTTTAGGACGGGTAGGTCTCAACTGTCCTCGACTGATTGAGTTAGTGGTGTGTGCTAATGATCTTCAGCCTCTTGATAATGAACTTATTTGTATTGCTGAACACTGTACAAACCTAACAGCCTTGGGCCTCAGCAAATGTGAAGTTAGCTGCAGTGCCTTCATCAGGTTTGTAAGACTGTGTGAGAGAAGGTTAACACAGCTCTCTGTAATGGAGGAAGTTTTGATCCCTGATGAGGATTATAGCCTAGATGAAATTCACACTGAAGTCTCCAAATACCTGGGAAGAGTATGGTTCCCTGATGTGATGCCTCTCTGGTAA
Sequence Length
417
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,152 Da
NCBI Official Full Name
Homo sapiens F-box and leucine-rich repeat protein 21, mRNA
NCBI Official Synonym Full Names
F-box and leucine rich repeat protein 21 (gene/pseudogene)
NCBI Official Symbol
FBXL21
NCBI Official Synonym Symbols
FBL3B; Fbl21; FBXL3B; FBXL3P
NCBI Protein Information
F-box/LRR-repeat protein 21
UniProt Protein Name
F-box/LRR-repeat protein 21
Protein Family
UniProt Gene Name
FBXL21
UniProt Synonym Gene Names
FBL21; FBL3; FBXL3B; FBXL3P
UniProt Entry Name
FXL21_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 6 tandem leucine-rich repeats. The amino acid sequence of this protein is highly similar to that of f-box and leucine-rich repeat protein 3A. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Jul 2015]

Uniprot Description

FBXL21: Substrate-recognition component of some SCF (SKP1-CUL1- F-box protein)-type E3 ubiquitin ligase complex involved in circadian pacemaker function. The SCF(FBXL21) complex acts by mediating ubiquitination and subsequent degradation of CRY1. Probable clock-controlled protein that plays a specific role in suprachiasmatic nucleus, SCN and pacemaker function.

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: cytosol; nucleus; SCF ubiquitin ligase complex

Biological Process: entrainment of circadian clock by photoperiod; protein ubiquitination

Research Articles on FBXL21

Similar Products

Product Notes

The FBXL21 fbxl21 (Catalog #AAA1267740) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCACTTCT TTCTATATGA AGAGGAATTC GAGACGTTCT TCAAAGAAGA AACCCCTGTT ACTCACCTTT ATTTTGGTCG TTCAGTCAGC AAAGTGGTTT TAGGACGGGT AGGTCTCAAC TGTCCTCGAC TGATTGAGTT AGTGGTGTGT GCTAATGATC TTCAGCCTCT TGATAATGAA CTTATTTGTA TTGCTGAACA CTGTACAAAC CTAACAGCCT TGGGCCTCAG CAAATGTGAA GTTAGCTGCA GTGCCTTCAT CAGGTTTGTA AGACTGTGTG AGAGAAGGTT AACACAGCTC TCTGTAATGG AGGAAGTTTT GATCCCTGAT GAGGATTATA GCCTAGATGA AATTCACACT GAAGTCTCCA AATACCTGGG AAGAGTATGG TTCCCTGATG TGATGCCTCT CTGGTAA. It is sometimes possible for the material contained within the vial of "FBXL21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.