Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXL19 cdna clone

FBXL19 cDNA Clone

Gene Names
FBXL19; Fbl19; CXXC11; JHDM1C
Synonyms
FBXL19; FBXL19 cDNA Clone; FBXL19 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaaggctgagggtgtcatcaatgcagagatccccaactgctgggagtgccctcgctgcacccaggaaggccgcaccagcaaggattcaggtgaggggcctggccgccgtagggccgacaacggcgaggagggcgccagcttggggagcggatggaagctgacagaggagccaccgcttccaccgcccccgcccaggcgcaagggccccctgcctgccgggccccccccggaggacgtgcctgggccccccaaacgaaaggaaagggaggcagggaatgagcctcccaccccaaggaaaaaggtgaaaggaggccgagagaggcacctgaagaagaaaccaaagccgcctttggcctctgcagagggcccagcggtgccgtccccgtccccgcagagggagaagctagagcgtttcaagcggatgtgccagctgctggaacgggtgcctgacacctcctcttcctcctcggactcagactccgactccgactcttcgggcacatcgctgagtgaggacgaagcccccggcgaggcccggaatgggcgacggccagcccggggcagctctggcgagaaggagaaccgtggggggcggcgggctgtgcgccctggcagtggggggcccctactcagctggcccctgggcccagccccaccaccccggcctccacagctggagcggcacgtggtgcggcccccgcctcgaagccctgagcccgacacactccccttggctgctggatccgaccaccccctgccccgggccgcctggcttcgcgtcttccagcacctcgggccgcgggagctgtgtatctgcatgcgagtctgccgaacttggagccgctggtgctatgacaagcgtctgtggcctcgaatggacctgagccggcggaagtcactgaccccgcccatgctcagtggtgtggttcgccgccagccccgtgccctggacctcagctggacaggtgtctccaagaagcagctcatgtggcttctgaaccgactacaaggcctgcaggagctggtgctctctggctgctcctggctctctgtctctgccctgggctcagccccactgccagccctgcggctcctggacctccgctggatcgaggatgttaaagactcccagctccgggagttgctgctgcctccaccagacaccaaaccagggcaaacagagagccgtggtcggctgcagggggtggcagaactgcgtctggcaggtttggagctgacagatgcctccctgcgtctcctgctgcgtcacgcaccccagctgagcgccctggacctgagccactgcgcccacgtcggggaccccagtgttcacctcctcacggcccccacgtccccactccgcgagaccctggtgcacctcaatcttgctggttgccaccgcctaacggaccactgcctcccgctgttccgccgctgccctcgtctacgccgcctagacctgcgctcctgccgccagctctcacccgaagcttgtgcccggctggcagctgccgggccccctggccccttccgctgccctgaggagaagctgcttctcaaggacagctag
Sequence Length
1575
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,253 Da
NCBI Official Full Name
Homo sapiens F-box and leucine-rich repeat protein 19, mRNA
NCBI Official Synonym Full Names
F-box and leucine rich repeat protein 19
NCBI Official Symbol
FBXL19
NCBI Official Synonym Symbols
Fbl19; CXXC11; JHDM1C
NCBI Protein Information
F-box/LRR-repeat protein 19
UniProt Protein Name
F-box/LRR-repeat protein 19
Protein Family
UniProt Gene Name
FBXL19
UniProt Synonym Gene Names
FBL19
UniProt Entry Name
FXL19_HUMAN

NCBI Description

This gene encodes a member of the Skp1-Cullin-F-box family of E3 ubiquitin ligases. The encoded protein is reported to bind to the transmembrane receptor interleukin 1 receptor-like 1 and regulate its ubiquitination and degradation. This protein has been linked to the regulation of pulmonary inflammation and psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

FBXL19: Substrate-recognition component of the SCF (SKP1-CUL1-F- box protein)-type E3 ubiquitin ligase complex. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: SCF ubiquitin ligase complex

Molecular Function: protein binding

Biological Process: proteasomal ubiquitin-dependent protein catabolic process

Research Articles on FBXL19

Similar Products

Product Notes

The FBXL19 fbxl19 (Catalog #AAA1269492) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaagg ctgagggtgt catcaatgca gagatcccca actgctggga gtgccctcgc tgcacccagg aaggccgcac cagcaaggat tcaggtgagg ggcctggccg ccgtagggcc gacaacggcg aggagggcgc cagcttgggg agcggatgga agctgacaga ggagccaccg cttccaccgc ccccgcccag gcgcaagggc cccctgcctg ccgggccccc cccggaggac gtgcctgggc cccccaaacg aaaggaaagg gaggcaggga atgagcctcc caccccaagg aaaaaggtga aaggaggccg agagaggcac ctgaagaaga aaccaaagcc gcctttggcc tctgcagagg gcccagcggt gccgtccccg tccccgcaga gggagaagct agagcgtttc aagcggatgt gccagctgct ggaacgggtg cctgacacct cctcttcctc ctcggactca gactccgact ccgactcttc gggcacatcg ctgagtgagg acgaagcccc cggcgaggcc cggaatgggc gacggccagc ccggggcagc tctggcgaga aggagaaccg tggggggcgg cgggctgtgc gccctggcag tggggggccc ctactcagct ggcccctggg cccagcccca ccaccccggc ctccacagct ggagcggcac gtggtgcggc ccccgcctcg aagccctgag cccgacacac tccccttggc tgctggatcc gaccaccccc tgccccgggc cgcctggctt cgcgtcttcc agcacctcgg gccgcgggag ctgtgtatct gcatgcgagt ctgccgaact tggagccgct ggtgctatga caagcgtctg tggcctcgaa tggacctgag ccggcggaag tcactgaccc cgcccatgct cagtggtgtg gttcgccgcc agccccgtgc cctggacctc agctggacag gtgtctccaa gaagcagctc atgtggcttc tgaaccgact acaaggcctg caggagctgg tgctctctgg ctgctcctgg ctctctgtct ctgccctggg ctcagcccca ctgccagccc tgcggctcct ggacctccgc tggatcgagg atgttaaaga ctcccagctc cgggagttgc tgctgcctcc accagacacc aaaccagggc aaacagagag ccgtggtcgg ctgcaggggg tggcagaact gcgtctggca ggtttggagc tgacagatgc ctccctgcgt ctcctgctgc gtcacgcacc ccagctgagc gccctggacc tgagccactg cgcccacgtc ggggacccca gtgttcacct cctcacggcc cccacgtccc cactccgcga gaccctggtg cacctcaatc ttgctggttg ccaccgccta acggaccact gcctcccgct gttccgccgc tgccctcgtc tacgccgcct agacctgcgc tcctgccgcc agctctcacc cgaagcttgt gcccggctgg cagctgccgg gccccctggc cccttccgct gccctgagga gaagctgctt ctcaaggaca gctag. It is sometimes possible for the material contained within the vial of "FBXL19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.