Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBLIM1 cdna clone

FBLIM1 cDNA Clone

Gene Names
FBLIM1; CAL; FBLP1; FBLP-1
Synonyms
FBLIM1; FBLIM1 cDNA Clone; FBLIM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcaaagcctgagaagagggtggcatcgtctgtctttatcaccctggcacccccgcgccgcgatgtggccgtggcggaggaagtgaggcaggcagtttgtgaggcccggcgtggccgcccctgggaggctcctgcccccatgaagacacccgaggctggcttggcggggaggcccagcccctggacaacccctggcagagctgcagccacagtgccggctgcacctatgcagctcttcaatggaggatgcccaccccctcctcctgtcctggatggtgaggacgtgcttcctgacctggacctcctcccaccccctccaccgccccctccagtgcttctgccttctgaagaggaggctcctgctccaatgggggcctcactcattgcagacttagagcagctgcacctgtccccgcccccgcccccaccacaggccccagcggagggaccttcagtccagcccggtcccctcaggcccatggaggaagagctgccacctcccccggcagaacctgttgagaaaggggcatccacagacatctgtgccttctgccacaagaccgtgttcccccgagagctggctgtggaggccatgaagaggcagtaccatgcccagtgcttcacgtgccgcacctgccgccgccagctggctgggcagagcttctaccagaaggatgggcgacccctctgcgaaccctgctaccaggacacactggagaggtgcggcaagtgtggcgaggtggtccgggaccacatcatcagggccctgggccaggccttccacccctcctgcttcacgtgtgtgacctgcgcccggtgcattggggatgagagctttgccctgggcagccagaacgaggtgtactgcctggacgacttctacaggaaattcgcccccgtctgcagcatctgtgaaaatcccatcatccctcgggatgggaaagatgccttcaaaatcgaatgcatgggaagaaacttccatgaaaattgctacaggtgtgaggactgcaggatcctcctgtctgtcgagcccacggaccaaggctgctaccccctgaacaaccatctcttctgcaagccatgccatgtgaagcggagtgctgcggggtgctgctga
Sequence Length
1122
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,770 Da
NCBI Official Full Name
Homo sapiens filamin binding LIM protein 1, mRNA
NCBI Official Synonym Full Names
filamin binding LIM protein 1
NCBI Official Symbol
FBLIM1
NCBI Official Synonym Symbols
CAL; FBLP1; FBLP-1
NCBI Protein Information
filamin-binding LIM protein 1
UniProt Protein Name
Filamin-binding LIM protein 1
UniProt Gene Name
FBLIM1
UniProt Synonym Gene Names
FBLP1; FBLP-1; MIG2-interacting protein
UniProt Entry Name
FBLI1_HUMAN

NCBI Description

This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

FBLIM1: Serves as an anchoring site for cell-ECM adhesion proteins and filamin-containing actin filaments. Is implicated in cell shape modulation (spreading) and motility. May participate in the regulation of filamin-mediated cross-linking and stabilization of actin filaments. May also regulate the assembly of filamin- containing signaling complexes that control actin assembly. Promotes dissociation of FLNA from ITGB3 and ITGB7. Promotes activation of integrins and regulates integrin-mediated cell-cell adhesion. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1p36.21

Cellular Component: cytosol; focal adhesion; stress fiber

Molecular Function: filamin binding; protein binding

Biological Process: cell-cell adhesion; regulation of integrin activation

Research Articles on FBLIM1

Similar Products

Product Notes

The FBLIM1 fblim1 (Catalog #AAA1271018) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcaa agcctgagaa gagggtggca tcgtctgtct ttatcaccct ggcacccccg cgccgcgatg tggccgtggc ggaggaagtg aggcaggcag tttgtgaggc ccggcgtggc cgcccctggg aggctcctgc ccccatgaag acacccgagg ctggcttggc ggggaggccc agcccctgga caacccctgg cagagctgca gccacagtgc cggctgcacc tatgcagctc ttcaatggag gatgcccacc ccctcctcct gtcctggatg gtgaggacgt gcttcctgac ctggacctcc tcccaccccc tccaccgccc cctccagtgc ttctgccttc tgaagaggag gctcctgctc caatgggggc ctcactcatt gcagacttag agcagctgca cctgtccccg cccccgcccc caccacaggc cccagcggag ggaccttcag tccagcccgg tcccctcagg cccatggagg aagagctgcc acctcccccg gcagaacctg ttgagaaagg ggcatccaca gacatctgtg ccttctgcca caagaccgtg ttcccccgag agctggctgt ggaggccatg aagaggcagt accatgccca gtgcttcacg tgccgcacct gccgccgcca gctggctggg cagagcttct accagaagga tgggcgaccc ctctgcgaac cctgctacca ggacacactg gagaggtgcg gcaagtgtgg cgaggtggtc cgggaccaca tcatcagggc cctgggccag gccttccacc cctcctgctt cacgtgtgtg acctgcgccc ggtgcattgg ggatgagagc tttgccctgg gcagccagaa cgaggtgtac tgcctggacg acttctacag gaaattcgcc cccgtctgca gcatctgtga aaatcccatc atccctcggg atgggaaaga tgccttcaaa atcgaatgca tgggaagaaa cttccatgaa aattgctaca ggtgtgagga ctgcaggatc ctcctgtctg tcgagcccac ggaccaaggc tgctaccccc tgaacaacca tctcttctgc aagccatgcc atgtgaagcg gagtgctgcg gggtgctgct ga. It is sometimes possible for the material contained within the vial of "FBLIM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.