Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FANCD2 cdna clone

FANCD2 cDNA Clone

Gene Names
FANCD2; FA4; FAD; FACD; FAD2; FA-D2; FANCD
Synonyms
FANCD2; FANCD2 cDNA Clone; FANCD2 cdna clone
Ordering
For Research Use Only!
Sequence
atggtttccaaaagaagactgtcaaaatctgaggataaagagagcctgacagaagatgcctccaaaaccaggaagcaaccactttccaaaaagacaaagaaatctcatattgctaatgaagttgaagaaaatgacagcatctttgtaaagcttcttaagatatcaggaattattcttaaaacgggagagagtcagaatcaactagctgtggatcaaatagctttccaaaagaagctctttcagaccctgaggagacacccttcctatcccaaaataatagaagaatttgttagtggcctggagtcttacattgaggatgaagacagtttcaggaactgccttttgtcttgtgagcgtctgcaggatgaggaagccagtatgggtgcatcttattctaagagtctcatcaaactgcttctggggattgacatactgcagcctgccattatcaaaaccttatttgagaagttgccagaatatttttttgaaaacaagaacagtgatgaaatcaacatacctcgactcattgtcagtcaactaaaatggcttgacagagttgtggatggcaaggacctcaccaccaagatcatgcagctgatcagtattgctccagagaacctgcagcatgacatcatcaccagcctacctgagatcctaggggattcccagcacgctgatgtggggaaagaactcaggtggataaaccctctgtcatcatctaagtga
Sequence Length
726
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,501 Da
NCBI Official Full Name
Homo sapiens Fanconi anemia, complementation group D2, mRNA
NCBI Official Synonym Full Names
Fanconi anemia complementation group D2
NCBI Official Symbol
FANCD2
NCBI Official Synonym Symbols
FA4; FAD; FACD; FAD2; FA-D2; FANCD
NCBI Protein Information
Fanconi anemia group D2 protein
UniProt Protein Name
Fanconi anemia group D2 protein
UniProt Gene Name
FANCD2
UniProt Synonym Gene Names
FACD; Protein FACD2
UniProt Entry Name
FACD2_HUMAN

NCBI Description

The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Uniprot Description

FANCD2: Required for maintenance of chromosomal stability. Promotes accurate and efficient pairing of homologs during meiosis. Involved in the repair of DNA double-strand breaks, both by homologous recombination and single-strand annealing. May participate in S phase and G2 phase checkpoint activation upon DNA damage. Plays a role in preventing breakage and loss of missegregating chromatin at the end of cell division, particularly after replication stress. Required for the targeting, or stabilization, of BLM to non-centromeric abnormal structures induced by replicative stress. Promotes BRCA2/FANCD1 loading onto damaged chromatin. May also be involved in B-cell immunoglobulin isotype switching. Interacts directly with FANCE and FANCI. Interacts with USP1 and MEN1. The ubiquitinated form specifically interacts with BRCA1 and BLM. Both the nonubiquitinated and the monoubiquitinated forms interact with BRCA2; this interaction is mediated by phosphorylated FANCG and the complex also includes XCCR3. The ubiquitinated form specifically interacts with MTMR15/FAN1 (via UBZ-type zinc finger), leading to recruit MTMR15/FAN1 to sites of DNA damage. Interacts with DCLRE1B/Apollo. Highly expressed in germinal center cells of the spleen, tonsil, and reactive lymph nodes, and in the proliferating basal layer of squamous epithelium of tonsil, esophagus, oropharynx, larynx and cervix. Expressed in cytotrophoblastic cells of the placenta and exocrine cells of the pancreas. Highly expressed in testis, where expression is restricted to maturing spermatocytes. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA repair, damage

Chromosomal Location of Human Ortholog: 3p26

Cellular Component: cytoplasm; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: response to gamma radiation

Disease: Fanconi Anemia, Complementation Group D2; Tracheoesophageal Fistula With Or Without Esophageal Atresia

Research Articles on FANCD2

Similar Products

Product Notes

The FANCD2 fancd2 (Catalog #AAA1276059) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtttcca aaagaagact gtcaaaatct gaggataaag agagcctgac agaagatgcc tccaaaacca ggaagcaacc actttccaaa aagacaaaga aatctcatat tgctaatgaa gttgaagaaa atgacagcat ctttgtaaag cttcttaaga tatcaggaat tattcttaaa acgggagaga gtcagaatca actagctgtg gatcaaatag ctttccaaaa gaagctcttt cagaccctga ggagacaccc ttcctatccc aaaataatag aagaatttgt tagtggcctg gagtcttaca ttgaggatga agacagtttc aggaactgcc ttttgtcttg tgagcgtctg caggatgagg aagccagtat gggtgcatct tattctaaga gtctcatcaa actgcttctg gggattgaca tactgcagcc tgccattatc aaaaccttat ttgagaagtt gccagaatat ttttttgaaa acaagaacag tgatgaaatc aacatacctc gactcattgt cagtcaacta aaatggcttg acagagttgt ggatggcaag gacctcacca ccaagatcat gcagctgatc agtattgctc cagagaacct gcagcatgac atcatcacca gcctacctga gatcctaggg gattcccagc acgctgatgt ggggaaagaa ctcaggtgga taaaccctct gtcatcatct aagtga. It is sometimes possible for the material contained within the vial of "FANCD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.