FAM82B cdna clone
FAM82B cDNA Clone
Gene Names
RMDN1; RMD1; RMD-1; CGI-90; FAM82B
Synonyms
FAM82B; FAM82B cDNA Clone; FAM82B cdna clone
Sequence
atggcgctggctgctcgactgtggcgccttctgcctttccgacgtggagccgccccggggtctcgtctccctgcggggacttcgggcagccgcgggcattgcggcccctgtcgattccgcggcttcgaggtaatgggaaacccaggaactttcaaaagaggccttttactctcagctttgtcgtatttgggttttgaaacttaccaggttatctctcaggctgctgtggttcatgccacagccaaagttgaagaaatacttgaacaagcagactacctgtatgaaagcggagaaacagaaaaactttatcagttgctaacccaatacaaggaaagtgaagatgcagagttactgtggcgtttggcacgggcatcacgtgatgtagctcagcttagcagaacctcagaagaggagaaaaagctattggtgtatgaagccctagagtatgcaaaaagagcactagaaaaaaatgaatcaagttttgcatctcataagtggtatgcaatctgccttagtgatgttggagattatgaaggcatcaaggctaaaattgcaaatgcatatatcatcaaggagcattttgagaaagcaattgaactgaaccctaaagatgctacttcaattcaccttatgggtatttggtgctatacatttgccgaaatgccttggtatcaaagaagaattgctaaaatgctgtttgcaactcctcctagttccacctatgagaaggccttaggctactttcacagggcagaacaagtggatccaaacttctacagcaaaaacttacttcttttaggaaagacatacttgaaactacacaacaaaaagcttgctgctttctggctaatgaaagccaaggactatccagcacacacagaggaggataaacagatacagacagaagctgctcagttgcttacaagtttcagtgagaagaattga
Sequence Length
945
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,847 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 82, member B, mRNA
NCBI Official Synonym Full Names
regulator of microtubule dynamics 1
NCBI Official Symbol
RMDN1
NCBI Official Synonym Symbols
RMD1; RMD-1; CGI-90; FAM82B
NCBI Protein Information
regulator of microtubule dynamics protein 1
UniProt Protein Name
Regulator of microtubule dynamics protein 1
UniProt Gene Name
RMDN1
UniProt Synonym Gene Names
FAM82B; RMD-1; hRMD-1
UniProt Entry Name
RMD1_HUMAN
Uniprot Description
FAM82B: Belongs to the FAM82/RMD family.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 8q21.3
Research Articles on FAM82B
1. Observational study of gene-disease association and gene-environment interaction. (HuGE Navigator)
Similar Products
Product Notes
The FAM82B rmdn1 (Catalog #AAA1267298) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgg ctgctcgact gtggcgcctt ctgcctttcc gacgtggagc cgccccgggg tctcgtctcc ctgcggggac ttcgggcagc cgcgggcatt gcggcccctg tcgattccgc ggcttcgagg taatgggaaa cccaggaact ttcaaaagag gccttttact ctcagctttg tcgtatttgg gttttgaaac ttaccaggtt atctctcagg ctgctgtggt tcatgccaca gccaaagttg aagaaatact tgaacaagca gactacctgt atgaaagcgg agaaacagaa aaactttatc agttgctaac ccaatacaag gaaagtgaag atgcagagtt actgtggcgt ttggcacggg catcacgtga tgtagctcag cttagcagaa cctcagaaga ggagaaaaag ctattggtgt atgaagccct agagtatgca aaaagagcac tagaaaaaaa tgaatcaagt tttgcatctc ataagtggta tgcaatctgc cttagtgatg ttggagatta tgaaggcatc aaggctaaaa ttgcaaatgc atatatcatc aaggagcatt ttgagaaagc aattgaactg aaccctaaag atgctacttc aattcacctt atgggtattt ggtgctatac atttgccgaa atgccttggt atcaaagaag aattgctaaa atgctgtttg caactcctcc tagttccacc tatgagaagg ccttaggcta ctttcacagg gcagaacaag tggatccaaa cttctacagc aaaaacttac ttcttttagg aaagacatac ttgaaactac acaacaaaaa gcttgctgct ttctggctaa tgaaagccaa ggactatcca gcacacacag aggaggataa acagatacag acagaagctg ctcagttgct tacaagtttc agtgagaaga attga. It is sometimes possible for the material contained within the vial of "FAM82B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
