Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM82A2 cdna clone

FAM82A2 cDNA Clone

Gene Names
RMDN3; RMD3; RMD-3; FAM82C; FAM82A2; ptpip51
Synonyms
FAM82A2; FAM82A2 cDNA Clone; FAM82A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctagactgggagccctgggtggtgcccgtgccgggctgggactgttgctgggtaccgccgccggccttggattcctgtgcctcctttacagccagcgatggaaacggacccagcgtcatggccgcagccagagcctgcccaactccctggactatacgcagacttcagatcccggacgccacgtgatgctcctgcgggctgtcccaggtggggctggagatgcctcagtgctgcccagccttccacgggaaggacaggagaaggtgctggaccgcctggactttgtgctgaccagccttgtggcgctgcggcgggaggtggaggagctgagaagcagcctgcgagggcttgcgggggagattgttggggaggtccgatgccacatggaagagaaccagagagtggctcggcggcgaaggtttccgtttgtccgggagaggagtgactccactggctccagctctgtctacttcacggcctcctcgggagccacgttcacagatgctgagagtgaagggggttacacaacagccaatgcggagtctgacaatgagcgggactctgacaaagaaagtgaggacggggaagatgaagtgagctgtgagactgtgaagatggggagaaaggattctcttgacttggaggaagaggcagcttcaggtgcctccagtgccctggaggctggaggttcctcaggcttggaggatgtgctgcccctcctgcagcaggccgacgagctgcacaggggtgatgagcaaggcaagcgggagggcttccagctgctgctcaacaacaagctggtgtatggaagccggcaggactttctctggcgcctggcccgagcctacagtgacatgtgtgagctcactgaggaggtgagcgagaagaagtcatatgccctagatggaaaagaagaagcagaggctgctctggagaagggggatgagagtgctgactgtcacctgtggtatgcggtgctttgtggtcagctggctgagcatgagagcatccagaggcgcatccagagtggctttagcttcaaggagcatgtggacaaagccattgctctccagccagaaaaccccatggctcactttcttcttggcaggtggtgctatcaggtctctcacctgagctggctagaaaaaaaaactgctacagccttgcttgaaagccctctcagtgccactgtggaagatgccctccagagcttcctaaaggctgaagaactacagccaggattttccaaagcaggaagggtatatatttccaagtgctacagagaactagggaaaaactctgaagctagatggtggatgaagttggccctggagctgccagatgtcacgaaggaggatttggctatccagaaggacctggaagaactggaagtcattttacgagactaa
Sequence Length
1413
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,247 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 82, member A2, mRNA
NCBI Official Synonym Full Names
regulator of microtubule dynamics 3
NCBI Official Symbol
RMDN3
NCBI Official Synonym Symbols
RMD3; RMD-3; FAM82C; FAM82A2; ptpip51
NCBI Protein Information
regulator of microtubule dynamics protein 3
UniProt Protein Name
Regulator of microtubule dynamics protein 3
UniProt Gene Name
RMDN3
UniProt Synonym Gene Names
FAM82A2; FAM82C; PTPIP51; RMD-3; hRMD-3
UniProt Entry Name
RMD3_HUMAN

Uniprot Description

FAM82A2: a single-pass membrane protein in the mitochondrial membrane. May participate in differentiation and apoptosis of keratinocytes. Overexpression induces apoptosis. Present at high level in epidermis and seminiferous epithelium: while basal cells in the epidermis and spermatogonia show no perceptible amount, keratinocytes of suprabasal layers and differentiating first-order spermatocytes up to spermatids exhibit high expression. In skeletal muscle, its presence is restricted to fibers of the fast twitch type. In surface epithelia containing ciliated cells, it is associated with the microtubular structures responsible for ciliary movement. Also present in specific structures of the central nervous system such as neurons of the hippocampal region, ganglion cells of the autonomic nervous system, and axons of the peripheral nervous system. Induced by EGF, TGF-beta, retinoic acid-and 1,25-Dihydroxyvitamin D(3). Two alternatively spliced human isoforms may be produced.

Protein type: Mitochondrial; Membrane protein, integral; Apoptosis

Chromosomal Location of Human Ortholog: 15q15.1

Cellular Component: mitochondrial outer membrane; mitochondrion

Molecular Function: protein binding

Biological Process: cellular calcium ion homeostasis

Research Articles on FAM82A2

Similar Products

Product Notes

The FAM82A2 rmdn3 (Catalog #AAA1271113) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctagac tgggagccct gggtggtgcc cgtgccgggc tgggactgtt gctgggtacc gccgccggcc ttggattcct gtgcctcctt tacagccagc gatggaaacg gacccagcgt catggccgca gccagagcct gcccaactcc ctggactata cgcagacttc agatcccgga cgccacgtga tgctcctgcg ggctgtccca ggtggggctg gagatgcctc agtgctgccc agccttccac gggaaggaca ggagaaggtg ctggaccgcc tggactttgt gctgaccagc cttgtggcgc tgcggcggga ggtggaggag ctgagaagca gcctgcgagg gcttgcgggg gagattgttg gggaggtccg atgccacatg gaagagaacc agagagtggc tcggcggcga aggtttccgt ttgtccggga gaggagtgac tccactggct ccagctctgt ctacttcacg gcctcctcgg gagccacgtt cacagatgct gagagtgaag ggggttacac aacagccaat gcggagtctg acaatgagcg ggactctgac aaagaaagtg aggacgggga agatgaagtg agctgtgaga ctgtgaagat ggggagaaag gattctcttg acttggagga agaggcagct tcaggtgcct ccagtgccct ggaggctgga ggttcctcag gcttggagga tgtgctgccc ctcctgcagc aggccgacga gctgcacagg ggtgatgagc aaggcaagcg ggagggcttc cagctgctgc tcaacaacaa gctggtgtat ggaagccggc aggactttct ctggcgcctg gcccgagcct acagtgacat gtgtgagctc actgaggagg tgagcgagaa gaagtcatat gccctagatg gaaaagaaga agcagaggct gctctggaga agggggatga gagtgctgac tgtcacctgt ggtatgcggt gctttgtggt cagctggctg agcatgagag catccagagg cgcatccaga gtggctttag cttcaaggag catgtggaca aagccattgc tctccagcca gaaaacccca tggctcactt tcttcttggc aggtggtgct atcaggtctc tcacctgagc tggctagaaa aaaaaactgc tacagccttg cttgaaagcc ctctcagtgc cactgtggaa gatgccctcc agagcttcct aaaggctgaa gaactacagc caggattttc caaagcagga agggtatata tttccaagtg ctacagagaa ctagggaaaa actctgaagc tagatggtgg atgaagttgg ccctggagct gccagatgtc acgaaggagg atttggctat ccagaaggac ctggaagaac tggaagtcat tttacgagac taa. It is sometimes possible for the material contained within the vial of "FAM82A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.