Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM58A cdna clone

FAM58A cDNA Clone

Gene Names
FAM58A; STAR
Synonyms
FAM58A; FAM58A cDNA Clone; FAM58A cdna clone
Ordering
For Research Use Only!
Sequence
atggaggcaggtgtcaagctagggatgcggtccattcccattgccactgcttgcaccatttaccataagttcttttgcgagaccaacctggacgcctatgacccttacctgattgccatgtcttcaatttacttggccggcaaagtggaagagcagcacctgcggactcgtgacatcatcaatgtgtccaacaggtactttaacccaagcggtgagcccctggaattggactcccgcttctgggaactccgggacagcatcgtgcagtgtgagcttctcatgctgagagttctgcgcttccaggtctccttccagcatccacacaagtacctgctccactacctggtttccctccagaactggctgaaccgccacagctggcagcggacccctgttgccgtcaccgcctgggccctgctgcgggacagctaccatggggcgctgtgcctccgcttccaggcccagcacatcgccgtggcggtgctctacctggccctgcaggtctacggagttgaggtgcccgccgaggtcgaggctgagaagccgtggtggcaggtgtttaatgacgaccttaccaagccaatcattgataatattgtgtctgatctcattcagatttataccatggacacagagatcccctaa
Sequence Length
645
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,114 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 58, member A, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 58 member A
NCBI Official Symbol
FAM58A
NCBI Official Synonym Symbols
STAR
NCBI Protein Information
cyclin-related protein FAM58A
UniProt Protein Name
Cyclin-related protein FAM58A
Protein Family
UniProt Gene Name
FAM58A
UniProt Entry Name
FA58A_HUMAN

NCBI Description

Mutations in this gene have been shown to cause an X-linked dominant STAR syndrome that typically manifests syndactyly, telecanthus and anogenital and renal malformations. The protein encoded by this gene contains a cyclin-box-fold domain which suggests it may have a role in controlling nuclear cell division cycles. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]

Uniprot Description

FAM58B: May have a role in cell proliferation. Defects in FAM58A are the cause of toe syndactyly, telecanthus, and anogenital and renal malformations (STAR); also known as STAR syndrome or syndactyly with renal and anogenital malformations. Belongs to the cyclin family. Cyclin-like FAM58 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: cyclin-dependent protein kinase holoenzyme complex; nucleus

Molecular Function: cyclin-dependent protein kinase regulator activity; protein binding

Biological Process: positive regulation of cyclin-dependent protein kinase activity; positive regulation of transcription from RNA polymerase II promoter

Disease: Toe Syndactyly, Telecanthus, And Anogenital And Renal Malformations

Research Articles on FAM58A

Similar Products

Product Notes

The FAM58A fam58a (Catalog #AAA1269145) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcag gtgtcaagct agggatgcgg tccattccca ttgccactgc ttgcaccatt taccataagt tcttttgcga gaccaacctg gacgcctatg acccttacct gattgccatg tcttcaattt acttggccgg caaagtggaa gagcagcacc tgcggactcg tgacatcatc aatgtgtcca acaggtactt taacccaagc ggtgagcccc tggaattgga ctcccgcttc tgggaactcc gggacagcat cgtgcagtgt gagcttctca tgctgagagt tctgcgcttc caggtctcct tccagcatcc acacaagtac ctgctccact acctggtttc cctccagaac tggctgaacc gccacagctg gcagcggacc cctgttgccg tcaccgcctg ggccctgctg cgggacagct accatggggc gctgtgcctc cgcttccagg cccagcacat cgccgtggcg gtgctctacc tggccctgca ggtctacgga gttgaggtgc ccgccgaggt cgaggctgag aagccgtggt ggcaggtgtt taatgacgac cttaccaagc caatcattga taatattgtg tctgatctca ttcagattta taccatggac acagagatcc cctaa. It is sometimes possible for the material contained within the vial of "FAM58A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.