FAM54A cdna clone
FAM54A cDNA Clone
Gene Names
MTFR2; DUFD1; FAM54A
Synonyms
FAM54A; FAM54A cDNA Clone; FAM54A cdna clone
Sequence
atgtctctcatactgaatatcttaagagagatgctggaatattttggcgttcctgtagaacaggttttgctgatttgggaaaataaagactatggatcaactaggagtattgttcgtattattgggaaaatgcttccactggaaccttgtcgaagacctaattttgagttgatcccgctcttgaactctgtagactctgataattgtggatctatggttccatcttttgctgatattttgtatgtggcaaatgatgaagaagccagttatctcagatttcgaaatagtatatggaaaaatgaagaagagaaagtggaaatttttcatcctttgcgactagttcgggatccactgtcacctgctgtaagacagaaagaaactgtgaaaaatgacctgcctgtaaatgaagctgcaattagaaaaatagctgcccttgaaaatgagctgacttttcttcgctctcagattgcagcaattgtggaaatgcaggaactgaaaaatagtacaaattctagttcctttggcttgagtgacgagcgcattagtttgggtcagctgtcatcatcgcgggctgcccatctgagtgtggacccagatcagcttccaggttcagtgctttctcctcctcctcctccaccacttcctcctcagttttcatctctccagccaccgtgttttcctcccgtacaaccaggatctaataatatttgtgactcagataatccagcaactgaaatgagcaaacagaacccggctgctaataagaccaattatagtcatcattcaaaaagccagagaaataaagatattccaaacatgttggacgttctaaaggatatgaataaggttaagcttcgtgcaattgagcggtcacctggcggtagacccattcataagaggaaaagacagaattcacattgggatccagtttctttaatatctcatgcacttaaacagaaatttgcatttcaagaagatgattcttttgagaaagagaatagatcttgggaatcttccccattttctagtccagaaacttcaaggtttggacatcacatttcacagtcagaaggacagcgaactaaagaagaaatggtcaacacaaaagctgttgaccaaggtatcagcaacacaagccttctaaactcaaggatttaa
Sequence Length
1158
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
5,116 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 54, member A, mRNA
NCBI Official Synonym Full Names
mitochondrial fission regulator 2
NCBI Official Symbol
MTFR2
NCBI Official Synonym Symbols
DUFD1; FAM54A
NCBI Protein Information
mitochondrial fission regulator 2
UniProt Protein Name
Mitochondrial fission regulator 2
UniProt Gene Name
MTFR2
UniProt Synonym Gene Names
DUFD1; FAM54A
UniProt Entry Name
MTFR2_HUMAN
Uniprot Description
FAM54A: May play a role in mitochondrial aerobic respiration essentially in the testis. Can also promote mitochondrial fission. Belongs to the MTFR1/FAM54 family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 6q23.3
Cellular Component: mitochondrion
Molecular Function: protein binding
Biological Process: aerobic respiration; mitochondrial fission; mitochondrion organization and biogenesis
Similar Products
Product Notes
The FAM54A mtfr2 (Catalog #AAA1278721) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctctca tactgaatat cttaagagag atgctggaat attttggcgt tcctgtagaa caggttttgc tgatttggga aaataaagac tatggatcaa ctaggagtat tgttcgtatt attgggaaaa tgcttccact ggaaccttgt cgaagaccta attttgagtt gatcccgctc ttgaactctg tagactctga taattgtgga tctatggttc catcttttgc tgatattttg tatgtggcaa atgatgaaga agccagttat ctcagatttc gaaatagtat atggaaaaat gaagaagaga aagtggaaat ttttcatcct ttgcgactag ttcgggatcc actgtcacct gctgtaagac agaaagaaac tgtgaaaaat gacctgcctg taaatgaagc tgcaattaga aaaatagctg cccttgaaaa tgagctgact tttcttcgct ctcagattgc agcaattgtg gaaatgcagg aactgaaaaa tagtacaaat tctagttcct ttggcttgag tgacgagcgc attagtttgg gtcagctgtc atcatcgcgg gctgcccatc tgagtgtgga cccagatcag cttccaggtt cagtgctttc tcctcctcct cctccaccac ttcctcctca gttttcatct ctccagccac cgtgttttcc tcccgtacaa ccaggatcta ataatatttg tgactcagat aatccagcaa ctgaaatgag caaacagaac ccggctgcta ataagaccaa ttatagtcat cattcaaaaa gccagagaaa taaagatatt ccaaacatgt tggacgttct aaaggatatg aataaggtta agcttcgtgc aattgagcgg tcacctggcg gtagacccat tcataagagg aaaagacaga attcacattg ggatccagtt tctttaatat ctcatgcact taaacagaaa tttgcatttc aagaagatga ttcttttgag aaagagaata gatcttggga atcttcccca ttttctagtc cagaaacttc aaggtttgga catcacattt cacagtcaga aggacagcga actaaagaag aaatggtcaa cacaaaagct gttgaccaag gtatcagcaa cacaagcctt ctaaactcaa ggatttaa. It is sometimes possible for the material contained within the vial of "FAM54A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
