Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM54A cdna clone

FAM54A cDNA Clone

Gene Names
MTFR2; DUFD1; FAM54A
Synonyms
FAM54A; FAM54A cDNA Clone; FAM54A cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggaactgaaaaatagtacaaattctagttcctttggcttgagtgacgagcgcattagtttgggtcagctgtcatcatcgcgggctgcccatctgagtgtggacccagatcagcttccaggttcagtgctttctcctcctcctcctccaccacttcctcctcagttttcatctctccagccaccgtgttttcctcccgtacaaccaggatctaataatatttgtgactcagataatccagcaactgaaatgagcaaacagaacccggctgctaataagaccaattatagtcatcattcaaaaagccagagaaataaagatattccaaacatgttggacgttctaaaggatatgaataaggttaagcttcgtgcaattgagcggtcacctggcggtagacccattcataagaggaaaagacagaattcacattgggatccagtttctttaatatctcatgcacttaaacagaaatttgcatttcaagaagatgattcttttgagaaagagaatagatcttgggaatcttccccattttctagtccagaaacttcaaggtttggacatcacatttcacagtcagaaggacagcgaactaaagaagaaatggtcaacacaaaagctgttgaccaaggtatcagcaacacaagccttctaaactcaaggatttaa
Sequence Length
675
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
5,116 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 54, member A, mRNA
NCBI Official Synonym Full Names
mitochondrial fission regulator 2
NCBI Official Symbol
MTFR2
NCBI Official Synonym Symbols
DUFD1; FAM54A
NCBI Protein Information
mitochondrial fission regulator 2
UniProt Protein Name
Mitochondrial fission regulator 2
UniProt Gene Name
MTFR2
UniProt Synonym Gene Names
DUFD1; FAM54A
UniProt Entry Name
MTFR2_HUMAN

Uniprot Description

FAM54A: May play a role in mitochondrial aerobic respiration essentially in the testis. Can also promote mitochondrial fission. Belongs to the MTFR1/FAM54 family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 6q23.3

Cellular Component: mitochondrion

Molecular Function: protein binding

Biological Process: aerobic respiration; mitochondrial fission; mitochondrion organization and biogenesis

Similar Products

Product Notes

The FAM54A mtfr2 (Catalog #AAA1270391) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggaac tgaaaaatag tacaaattct agttcctttg gcttgagtga cgagcgcatt agtttgggtc agctgtcatc atcgcgggct gcccatctga gtgtggaccc agatcagctt ccaggttcag tgctttctcc tcctcctcct ccaccacttc ctcctcagtt ttcatctctc cagccaccgt gttttcctcc cgtacaacca ggatctaata atatttgtga ctcagataat ccagcaactg aaatgagcaa acagaacccg gctgctaata agaccaatta tagtcatcat tcaaaaagcc agagaaataa agatattcca aacatgttgg acgttctaaa ggatatgaat aaggttaagc ttcgtgcaat tgagcggtca cctggcggta gacccattca taagaggaaa agacagaatt cacattggga tccagtttct ttaatatctc atgcacttaa acagaaattt gcatttcaag aagatgattc ttttgagaaa gagaatagat cttgggaatc ttccccattt tctagtccag aaacttcaag gtttggacat cacatttcac agtcagaagg acagcgaact aaagaagaaa tggtcaacac aaaagctgtt gaccaaggta tcagcaacac aagccttcta aactcaagga tttaa. It is sometimes possible for the material contained within the vial of "FAM54A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.