Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM3B cdna clone

FAM3B cDNA Clone

Gene Names
FAM3B; 2-21; ORF9; PANDER; PRED44; C21orf11; C21orf76
Synonyms
FAM3B; FAM3B cDNA Clone; FAM3B cdna clone
Ordering
For Research Use Only!
Sequence
atgcgcccattggctggtggcctgctcaaggtggtgttcgtggtcttcgcctccttgtgtgcctggtattcggggtacctgctcgcagagctcattccagatgcacccctgtccagtgctgcctatagcatccgcagcatcggggagaggcctgtcctcaaagctccagtccccaaaaggcaaaaatgtgaccactggactccctgcccatctgacacctatgcctacaggttactcagcggaggtggcagaagcaagtacgccaaaatctgctttgaggataacctacttatgggagaacagctgggaaatgttgccagaggaataaacattgccattgtcaactatgtaactgggaatgtgacagcaacacgatgttttgatatgtatgaaggcgataactctggaccgatgacaaagtttattcagagtgctgctccaaaatccctgctcttcatggtgacctatgacgacggaagcacaagactgaataacgatgccaagaatgccatagaagcacttggaagtaaagaaatcaggaacatgaaattcaggtctagctgggtatttattgcagcaaaaggcttggaactcccttccgaaattcagagagaaaagatcaaccactctgatgctaagaacaacagatattctggctggcctgcagagatccagatagaaggctgcatacccaaagaacgaagctga
Sequence Length
708
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,815 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 3, member B, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 3 member B
NCBI Official Symbol
FAM3B
NCBI Official Synonym Symbols
2-21; ORF9; PANDER; PRED44; C21orf11; C21orf76
NCBI Protein Information
protein FAM3B
UniProt Protein Name
Protein FAM3B
Protein Family
UniProt Gene Name
FAM3B
UniProt Synonym Gene Names
C21orf11; C21orf76; PANDER
UniProt Entry Name
FAM3B_HUMAN

Uniprot Description

FAM3B: Induces apoptosis of alpha and beta cells in a dose- and time-dependent manner. Present in insulin secretory granules and likely cosecreted with insulin. Belongs to the FAM3 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; Secreted, signal peptide; Cytokine; Nuclear envelope; Secreted

Chromosomal Location of Human Ortholog: 21q22.3

Biological Process: insulin secretion

Research Articles on FAM3B

Similar Products

Product Notes

The FAM3B fam3b (Catalog #AAA1273916) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgcccat tggctggtgg cctgctcaag gtggtgttcg tggtcttcgc ctccttgtgt gcctggtatt cggggtacct gctcgcagag ctcattccag atgcacccct gtccagtgct gcctatagca tccgcagcat cggggagagg cctgtcctca aagctccagt ccccaaaagg caaaaatgtg accactggac tccctgccca tctgacacct atgcctacag gttactcagc ggaggtggca gaagcaagta cgccaaaatc tgctttgagg ataacctact tatgggagaa cagctgggaa atgttgccag aggaataaac attgccattg tcaactatgt aactgggaat gtgacagcaa cacgatgttt tgatatgtat gaaggcgata actctggacc gatgacaaag tttattcaga gtgctgctcc aaaatccctg ctcttcatgg tgacctatga cgacggaagc acaagactga ataacgatgc caagaatgcc atagaagcac ttggaagtaa agaaatcagg aacatgaaat tcaggtctag ctgggtattt attgcagcaa aaggcttgga actcccttcc gaaattcaga gagaaaagat caaccactct gatgctaaga acaacagata ttctggctgg cctgcagaga tccagataga aggctgcata cccaaagaac gaagctga. It is sometimes possible for the material contained within the vial of "FAM3B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.