FAM174A cdna clone
FAM174A cDNA Clone
Gene Names
FAM174A; TMEM157; UNQ1912; HGS_RE408
Synonyms
FAM174A; FAM174A cDNA Clone; FAM174A cdna clone
Sequence
atgaaggcctcgcagtgctgctgctgtctcagccacctcttggcttccgtcctcctcctgctgttgctgcctgaactaagcgggcccctggcagtcctgctgcaggcagccgaggccgcgccaggtcttgggcctcctgaccctagaccacggacattaccgccgctgccaccgggccctacccctgcccagcagccgggccgtggtctggctgaagctgcggggccgcggggctccgagggaggcaatggcagcaaccctgtggccgggcttgagacggacgatcacggagggaaggccggggaaggctcggtgggtggcggccttgctgtgagccccaaccctggcgacaagcccatgacccagcgggccctgaccgtgttgatggtggtgagcggcgcggtgctggtgtacttcgtggtcaggacggtcaggatgagaagaagaaaccgaaagactaggagatatggagttttggacactaacatagaaaatatggaattgacacctttagaacaggatgatgaggatgatgacaacacgttgtttgatgccaatcatcctcgaagataa
Sequence Length
573
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,954 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 174, member A, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 174 member A
NCBI Official Symbol
FAM174A
NCBI Official Synonym Symbols
TMEM157; UNQ1912; HGS_RE408
NCBI Protein Information
membrane protein FAM174A
UniProt Protein Name
Membrane protein FAM174A
Protein Family
UniProt Gene Name
FAM174A
UniProt Synonym Gene Names
NS5ATP6; TMEM157; HCV NS5A-transactivated protein 6
UniProt Entry Name
F174A_HUMAN
Uniprot Description
FAM174A: Belongs to the FAM174 family.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 5q21.1
Similar Products
Product Notes
The FAM174A fam174a (Catalog #AAA1266378) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggcct cgcagtgctg ctgctgtctc agccacctct tggcttccgt cctcctcctg ctgttgctgc ctgaactaag cgggcccctg gcagtcctgc tgcaggcagc cgaggccgcg ccaggtcttg ggcctcctga ccctagacca cggacattac cgccgctgcc accgggccct acccctgccc agcagccggg ccgtggtctg gctgaagctg cggggccgcg gggctccgag ggaggcaatg gcagcaaccc tgtggccggg cttgagacgg acgatcacgg agggaaggcc ggggaaggct cggtgggtgg cggccttgct gtgagcccca accctggcga caagcccatg acccagcggg ccctgaccgt gttgatggtg gtgagcggcg cggtgctggt gtacttcgtg gtcaggacgg tcaggatgag aagaagaaac cgaaagacta ggagatatgg agttttggac actaacatag aaaatatgga attgacacct ttagaacagg atgatgagga tgatgacaac acgttgtttg atgccaatca tcctcgaaga taa. It is sometimes possible for the material contained within the vial of "FAM174A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
