Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM105B cdna clone

FAM105B cDNA Clone

Gene Names
OTULIN; GUM; FAM105B
Synonyms
FAM105B; FAM105B cDNA Clone; FAM105B cdna clone
Ordering
For Research Use Only!
Sequence
atgagccaggctgtggggctgccgccctggctgcaggacccggagctcatgctgttaccagaaaaactcataagcaaatacaactggatcaagcaatggaaacttggactgaaatttgatgggaagaatgaggacctggttgataaaattaaagagtcccttactctgctgaggaagaagtgggcaggcttggctgaaatgagaactgctgaagcaagacagatagcttgtgatgaactattcacaaatgaggcggaggaatatagcctctatgaagctgtaaaatttctaatgctaaacagagccattgaactatataatgataaagagaaaggaaaggaagtaccatttttctctgtgcttctgtttgctcgggacacatcaaatgacccaggacagcttctgaggaaccacctcaaccaggtgggacacactggtggtcttgaacaggttgaaatgttccttcttgcctatgctgtgcgccacaccatccaggtgtaccggctctccaagtacaacacggaagaattcatcacagtctaccccaccgacccacccaaggactggccagtggtaacgctcattgctgaggacgatcggcactataacatccccgtcagagtgtgtgaggagaccagtctatga
Sequence Length
645
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,263 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 105, member B, mRNA
NCBI Official Synonym Full Names
OTU deubiquitinase with linear linkage specificity
NCBI Official Symbol
OTULIN
NCBI Official Synonym Symbols
GUM; FAM105B
NCBI Protein Information
ubiquitin thioesterase otulin
UniProt Protein Name
Ubiquitin thioesterase otulin
UniProt Gene Name
OTULIN
UniProt Synonym Gene Names
FAM105B
UniProt Entry Name
OTUL_HUMAN

Uniprot Description

FAM105B: Belongs to the FAM105 family.

Protein type: EC 3.4.19.12

Chromosomal Location of Human Ortholog: 5p15.2

Cellular Component: cytoplasm; cytosol

Molecular Function: cysteine-type peptidase activity; protein binding; ubiquitin-specific protease activity

Biological Process: inhibition of NF-kappaB transcription factor; innate immune response; negative regulation of inflammatory response; sprouting angiogenesis; Wnt receptor signaling pathway through beta-catenin

Research Articles on FAM105B

Similar Products

Product Notes

The FAM105B otulin (Catalog #AAA1271461) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccagg ctgtggggct gccgccctgg ctgcaggacc cggagctcat gctgttacca gaaaaactca taagcaaata caactggatc aagcaatgga aacttggact gaaatttgat gggaagaatg aggacctggt tgataaaatt aaagagtccc ttactctgct gaggaagaag tgggcaggct tggctgaaat gagaactgct gaagcaagac agatagcttg tgatgaacta ttcacaaatg aggcggagga atatagcctc tatgaagctg taaaatttct aatgctaaac agagccattg aactatataa tgataaagag aaaggaaagg aagtaccatt tttctctgtg cttctgtttg ctcgggacac atcaaatgac ccaggacagc ttctgaggaa ccacctcaac caggtgggac acactggtgg tcttgaacag gttgaaatgt tccttcttgc ctatgctgtg cgccacacca tccaggtgta ccggctctcc aagtacaaca cggaagaatt catcacagtc taccccaccg acccacccaa ggactggcca gtggtaacgc tcattgctga ggacgatcgg cactataaca tccccgtcag agtgtgtgag gagaccagtc tatga. It is sometimes possible for the material contained within the vial of "FAM105B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.