Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EXOSC8 cdna clone

EXOSC8 cDNA Clone

Gene Names
EXOSC8; p9; CIP3; EAP2; OIP2; PCH1C; RRP43; Rrp43p; bA421P11.3
Synonyms
EXOSC8; EXOSC8 cDNA Clone; EXOSC8 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggctgggttcaaaaccgtggaacctctggagtattacaggagatttctgaaagagaactgccgtcctgatggaagagaacttggtgaattcagaaccacaactgtcaacatcggttcaattagtaccgcagatggttctgctttagtgaagttgggaaatactacagtaatctgtggagttaaagcagaatttgcagcaccatcaacagatgcccctgataaaggatacgttgttcctaatgtggatctaccacccctgtgttcatcgagattccggtctggacctcctggagaagaggcccaagtggctagccaattcattgcagatgtcattgaaaattcacagataattcagaaagaggacttatgcatttctccaggaaagcttgtctgggttctatactgtgatctcatttgcctcgactacgatggaaacattttggatgcctgcacatttgctttgctagcggctttaaaaaatgtacagttgcctgaagttactataaatgaagaaactgctttagcagaagttaatttaaagaagaaaagttatttgaatattagaactcatccagttgcaacttcctttgctgtgtttgatgacactttgcttatagttgaccctactggagaggaggaacatctggcaacaggaaccttaacaatagtaatggatgaggaaggcaaactctgttgtcttcacaaaccaggtggaagtgggctaactggagctaaacttcaggactgtatgagccgagcagttacaagacacaaagaagttaaaaaactgatggatgaagtaattaagagtatgaaacccaaataa
Sequence Length
831
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,040 Da
NCBI Official Full Name
Homo sapiens exosome component 8, mRNA
NCBI Official Synonym Full Names
exosome component 8
NCBI Official Symbol
EXOSC8
NCBI Official Synonym Symbols
p9; CIP3; EAP2; OIP2; PCH1C; RRP43; Rrp43p; bA421P11.3
NCBI Protein Information
exosome complex component RRP43
UniProt Protein Name
Exosome complex component RRP43
Protein Family
UniProt Gene Name
EXOSC8
UniProt Synonym Gene Names
OIP2; RRP43; OIP-2
UniProt Entry Name
EXOS8_HUMAN

NCBI Description

This gene encodes a 3'-5' exoribonuclease that specifically interacts with mRNAs containing AU-rich elements. The encoded protein is part of the exosome complex that is important for the degradation of numerous RNA species. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2009]

Uniprot Description

EXOSC8: Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC8 binds to ARE-containing RNAs. Belongs to the RNase PH family.

Protein type: Nucleolus; Ribonuclease; EC 3.1.13.-

Chromosomal Location of Human Ortholog: 13q13.1

Cellular Component: cytoplasm; cytosol; exosome (RNase complex); nuclear exosome (RNase complex); nucleoplasm; nucleus

Molecular Function: AU-rich element binding; exoribonuclease activity; protein binding

Biological Process: exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); regulation of mRNA stability; rRNA processing

Disease: Pontocerebellar Hypoplasia, Type 1c

Research Articles on EXOSC8

Similar Products

Product Notes

The EXOSC8 exosc8 (Catalog #AAA1275968) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg ggttcaaaac cgtggaacct ctggagtatt acaggagatt tctgaaagag aactgccgtc ctgatggaag agaacttggt gaattcagaa ccacaactgt caacatcggt tcaattagta ccgcagatgg ttctgcttta gtgaagttgg gaaatactac agtaatctgt ggagttaaag cagaatttgc agcaccatca acagatgccc ctgataaagg atacgttgtt cctaatgtgg atctaccacc cctgtgttca tcgagattcc ggtctggacc tcctggagaa gaggcccaag tggctagcca attcattgca gatgtcattg aaaattcaca gataattcag aaagaggact tatgcatttc tccaggaaag cttgtctggg ttctatactg tgatctcatt tgcctcgact acgatggaaa cattttggat gcctgcacat ttgctttgct agcggcttta aaaaatgtac agttgcctga agttactata aatgaagaaa ctgctttagc agaagttaat ttaaagaaga aaagttattt gaatattaga actcatccag ttgcaacttc ctttgctgtg tttgatgaca ctttgcttat agttgaccct actggagagg aggaacatct ggcaacagga accttaacaa tagtaatgga tgaggaaggc aaactctgtt gtcttcacaa accaggtgga agtgggctaa ctggagctaa acttcaggac tgtatgagcc gagcagttac aagacacaaa gaagttaaaa aactgatgga tgaagtaatt aagagtatga aacccaaata a. It is sometimes possible for the material contained within the vial of "EXOSC8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.