Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EXOSC3 cdna clone

EXOSC3 cDNA Clone

Gene Names
EXOSC3; p10; PCH1B; RRP40; Rrp40p; CGI-102; hRrp-40; bA3J10.7
Synonyms
EXOSC3; EXOSC3 cDNA Clone; EXOSC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgaacctgcgtctgtcgcggctgaatctctcgcgggcagcagggcgcgcgctgcacgcacagtactaggtcaggtggtgctcccgggtgaggagctgctcctgccggaacaggaggacgcggaaggccctgggggtgcagtggagcgaccgttgagcctgaatgctagagcgtgctcgcgggtgcgcgttgtatgcggtccgggccttcggcgctgtggggaccgcctgctggtcaccaagtgcggccgcctccgtcacaaggagcccggcagtggcagcggcggcggtgtttactgggtggactctcagcagaagcggtatgttccagtaaaaggagaccatgtgattggcatagtgacagctaaatctggagatatattcaaagttgatgttggagggagtgagccagcttctttgtcttacttgtcatttgaaggtgcaactaaaagaaacagaccaaatgtgcaggttggagatctcatctatggccagtttgtggttgctaataaagacatggaaccagagatggtctgtattgacagctgtggacgagccaatggaatgggtgtcattggacaggatggtctgctttttaaagtgactctgggcttaattagaaagctattagctccagattgtgaaatcatacaggaagtgggaaaactctatccactggagatagtatttggaatgaatggaagaatatgggttaaggcaaaaaccatccagcagactttaattttggcaaacattttagaagcttgtgaacacatgacgtcagatcaaagaaaacagatcttctccagattggcagaaagttga
Sequence Length
828
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,248 Da
NCBI Official Full Name
Homo sapiens exosome component 3, mRNA
NCBI Official Synonym Full Names
exosome component 3
NCBI Official Symbol
EXOSC3
NCBI Official Synonym Symbols
p10; PCH1B; RRP40; Rrp40p; CGI-102; hRrp-40; bA3J10.7
NCBI Protein Information
exosome complex component RRP40
UniProt Protein Name
Exosome complex component RRP40
Protein Family
UniProt Gene Name
EXOSC3
UniProt Synonym Gene Names
RRP40
UniProt Entry Name
EXOS3_HUMAN

NCBI Description

This gene encodes a non-catalytic component of the human exosome, a complex with 3'-5' exoribonuclease activity that plays a role in numerous RNA processing and degradation activities. Related pseudogenes of this gene are found on chromosome 19 and 21. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2012]

Uniprot Description

EXOSC3: Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC3 as peripheral part of the Exo-9 complex stabilizes the hexameric ring of RNase PH-domain subunits through contacts with EXOSC9 and EXOSC5. Defects in EXOSC3 are the cause of pontocerebellar hypoplasia type 1B (PCH1B). A severe autosomal recessive neurologic disorder characterized by a combination of cerebellar and spinal motor neuron degeneration beginning at birth. There is diffuse muscle weakness, progressive microcephaly, global developmental delay, and brainstem involvement. Belongs to the RRP40 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ribonuclease; RNA processing; Nucleolus; EC 3.1.13.-

Chromosomal Location of Human Ortholog: 9p11

Cellular Component: cytoplasm; cytosol; exosome (RNase complex); nuclear exosome (RNase complex); nucleolus; nucleoplasm; nucleus

Molecular Function: exoribonuclease activity; protein binding; RNA binding

Biological Process: DNA deamination; exonucleolytic trimming to generate mature 3'-end of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); isotype switching; regulation of mRNA stability; rRNA processing

Research Articles on EXOSC3

Similar Products

Product Notes

The EXOSC3 exosc3 (Catalog #AAA1267329) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgaac ctgcgtctgt cgcggctgaa tctctcgcgg gcagcagggc gcgcgctgca cgcacagtac taggtcaggt ggtgctcccg ggtgaggagc tgctcctgcc ggaacaggag gacgcggaag gccctggggg tgcagtggag cgaccgttga gcctgaatgc tagagcgtgc tcgcgggtgc gcgttgtatg cggtccgggc cttcggcgct gtggggaccg cctgctggtc accaagtgcg gccgcctccg tcacaaggag cccggcagtg gcagcggcgg cggtgtttac tgggtggact ctcagcagaa gcggtatgtt ccagtaaaag gagaccatgt gattggcata gtgacagcta aatctggaga tatattcaaa gttgatgttg gagggagtga gccagcttct ttgtcttact tgtcatttga aggtgcaact aaaagaaaca gaccaaatgt gcaggttgga gatctcatct atggccagtt tgtggttgct aataaagaca tggaaccaga gatggtctgt attgacagct gtggacgagc caatggaatg ggtgtcattg gacaggatgg tctgcttttt aaagtgactc tgggcttaat tagaaagcta ttagctccag attgtgaaat catacaggaa gtgggaaaac tctatccact ggagatagta tttggaatga atggaagaat atgggttaag gcaaaaacca tccagcagac tttaattttg gcaaacattt tagaagcttg tgaacacatg acgtcagatc aaagaaaaca gatcttctcc agattggcag aaagttga. It is sometimes possible for the material contained within the vial of "EXOSC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.