Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ESD cdna clone

ESD cDNA Clone

Gene Names
ESD; FGH
Synonyms
ESD; ESD cDNA Clone; ESD cdna clone
Ordering
For Research Use Only!
Sequence
atggcattgaagcagatttccagcaacaagtgctttgggggattgcagaaagtttttgaacatgacagtgttgaactaaactgcaaaatgaaatttgctgtctacttaccaccaaaggcagaaacaggaaagtgccctgcactgtattggctctcaggtttaacttgcacagagcaaaattttatatcaaaatctggttatcatcagtctgcttcagaacatggtcttgttgtcattgctccagataccagccctcgtggctgcaatattaaaggtgaagatgagagctgggactttggcactggtgctggattttatgttgatgccactgaagatccttggaaaaccaactacagaatgtactcttatgtcacagaggagcttccccaactcataaatgccaattttccagtggatccccaaaggatgtctatttttggccactccatgggaggtcatggagctctgatctgtgctttgaaaaatcctggaaaatacaaatctgtgtcagcatttgctccaatttgcaaccctgtactctgtccctggggcaaaaaagcctttagtggatatttgggaacagatcaaagtaaatggaaggcttatgatgctacccaccttgtgaaatcctatccaggatctcagctggacatactaattgatcaagggaaagatgaccagtttcttttagatggacagttactccctgataacttcatagctgcctgtacagaaaagaaaatccccgttgtttttcgattgcaagaggattatgatcatagctactacttcattgcaacctttattactgaccacatcagacatcatgctaaatacctgaatgcatga
Sequence Length
849
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,463 Da
NCBI Official Full Name
Homo sapiens esterase D/formylglutathione hydrolase, mRNA
NCBI Official Synonym Full Names
esterase D
NCBI Official Symbol
ESD
NCBI Official Synonym Symbols
FGH
NCBI Protein Information
S-formylglutathione hydrolase
UniProt Protein Name
S-formylglutathione hydrolase
UniProt Gene Name
ESD
UniProt Synonym Gene Names
FGH
UniProt Entry Name
ESTD_HUMAN

NCBI Description

This gene encodes a serine hydrolase that belongs to the esterase D family. The encoded enzyme is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. This gene is used as a genetic marker for retinoblastoma and Wilson's disease. [provided by RefSeq, Feb 2009]

Uniprot Description

esterase D: an enzyme that catalyzes the conversion of carboxylic esters and H2O into alcohol and a carboxylic anion.

Protein type: EC 3.1.2.12; Endoplasmic reticulum; Hydrolase; EC 3.1.1.56

Chromosomal Location of Human Ortholog: 13q14.1-q14.2

Cellular Component: endoplasmic reticulum lumen

Molecular Function: hydrolase activity, acting on ester bonds; protein binding; S-formylglutathione hydrolase activity

Research Articles on ESD

Similar Products

Product Notes

The ESD esd (Catalog #AAA1273911) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcattga agcagatttc cagcaacaag tgctttgggg gattgcagaa agtttttgaa catgacagtg ttgaactaaa ctgcaaaatg aaatttgctg tctacttacc accaaaggca gaaacaggaa agtgccctgc actgtattgg ctctcaggtt taacttgcac agagcaaaat tttatatcaa aatctggtta tcatcagtct gcttcagaac atggtcttgt tgtcattgct ccagatacca gccctcgtgg ctgcaatatt aaaggtgaag atgagagctg ggactttggc actggtgctg gattttatgt tgatgccact gaagatcctt ggaaaaccaa ctacagaatg tactcttatg tcacagagga gcttccccaa ctcataaatg ccaattttcc agtggatccc caaaggatgt ctatttttgg ccactccatg ggaggtcatg gagctctgat ctgtgctttg aaaaatcctg gaaaatacaa atctgtgtca gcatttgctc caatttgcaa ccctgtactc tgtccctggg gcaaaaaagc ctttagtgga tatttgggaa cagatcaaag taaatggaag gcttatgatg ctacccacct tgtgaaatcc tatccaggat ctcagctgga catactaatt gatcaaggga aagatgacca gtttctttta gatggacagt tactccctga taacttcata gctgcctgta cagaaaagaa aatccccgtt gtttttcgat tgcaagagga ttatgatcat agctactact tcattgcaac ctttattact gaccacatca gacatcatgc taaatacctg aatgcatga. It is sometimes possible for the material contained within the vial of "ESD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.