Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERO1L cdna clone

ERO1L cDNA Clone

Gene Names
ERO1A; ERO1L; ERO1-L; ERO1LA; Ero1alpha; ERO1-alpha; ERO1-L-alpha
Synonyms
ERO1L; ERO1L cDNA Clone; ERO1L cdna clone
Ordering
For Research Use Only!
Sequence
atgggccgcggctggggattcttgtttggcctcctgggcgccgtgtggctgctcagctcgggccacggagaggagcagcccccggagacagcggcacagaggtgcttctgccaggttagtggttacttggatgattgtacctgtgatgttgaaaccattgatagatttaataactacaggcttttcccaagactacaaaaacttcttgaaagtgactactttaggtattacaaggtaaacctgaagaggccgtgtcctttctggaatgacatcagccagtgtggaagaagggactgtgctgtcaaaccatgtcaatctgatgaagttcctgatggaattaaatctgcgagctacaagtattctgaagaagccaataatctcattgaagaatgtgaacaagctgaacgacttggagcagtggatgaatctctgagtgaggaaacacagaaggctgttcttcagtggaccaagcatgatgattcttcagataacttctgtgaagctgatgacattcagtcccctgaagctgaatatgtagatttgcttcttaatcctgagcgctacactggttacaagggaccagatgcttggaaaatatggaatgtcatctacgaagaaaactgttttaagccacagacaattaaaagacctttaaatcctttggcttctggtcaagggacaagtgaagagaacactttttacagttggctagaaggtctctgtgtagaaaaaagagcattctacagacttatatctggcctacatgcaagcattaatgtgcatttgagtgcaagatatcttttacaagagacctggttagaaaagaaatggggacacaacattacagaatttcaacagcgatttgatggaattttgactgaaggagaaggtccaagaaggcttaagaacttgtattttctctacttaatagaactaagggctttatccaaagtgttaccattcttcgagcgcccagattttcaactctttactggaaataaaattcaggatgaggaaaacaaaatgttacttctggaaatacttcatgaaatcaagtcatttcctttgcattttgatgagaattcattttttgctggggataaaaaagaagcacacaaactaaaggaggactttcgactgcattttagaaatatttcaagaattatggattgtgttggttgttttaaatgtcgtctgtggggaaagcttcagactcagggtttgggcactgctctgaagatcttattttctgagaaattgatagcaaatatgccagaaagtggacctagttatgaattccatctaaccagacaagaaatagtatcattattcaacgcatttggaagaatttctacaagtgtgaaagaattagaaaacttcaggaacttgttacagaatattcattaa
Sequence Length
1407
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,393 Da
NCBI Official Full Name
Homo sapiens ERO1-like (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
endoplasmic reticulum oxidoreductase 1 alpha
NCBI Official Symbol
ERO1A
NCBI Official Synonym Symbols
ERO1L; ERO1-L; ERO1LA; Ero1alpha; ERO1-alpha; ERO1-L-alpha
NCBI Protein Information
ERO1-like protein alpha
UniProt Protein Name
ERO1-like protein alpha
Protein Family
UniProt Gene Name
ERO1A
UniProt Synonym Gene Names
ERO1-L; ERO1-L-alpha
UniProt Entry Name
ERO1A_HUMAN

Uniprot Description

ERO1L: Essential oxidoreductase that oxidizes proteins in the endoplasmic reticulum to produce disulfide bonds. Acts by oxidizing directly P4HB/PDI isomerase through a direct disulfide exchange. Does not act as a direct oxidant of folding substrate, but relies on P4HB/PDI to transfer oxidizing equivalent. Associates with ERP44 but not with GRP54, demonstrating that it does not oxidize all PDI related proteins and can discriminate between PDI and related proteins. Its reoxidation probably involves electron transfer to molecular oxygen via FAD. Acts independently of glutathione. May be responsible for a significant proportion of reactive oxygen species (ROS) in the cell, thereby being a source of oxidative stress. Required for the folding of immunoglobulin proteins. Responsible for the release of the unfolded cholera toxin from reduced P4HB/PDI in case of infection by V.cholerae, thereby playing a role in retrotranslocation of the toxin. Predominantly monomer. May function both as a monomer and a homodimer. Interacts with PDILT. Stimulated by hypoxia; suggesting that it is regulated via the HIF-pathway. Widely expressed at low level. Expressed at high level in upper digestive tract. Highly expressed in esophagus. Weakly expressed in stomach and duodenum. Enzyme activity is tightly regulated to prevent the accumulation of reactive oxygen species in the endoplasmic reticulum. Reversibly down-regulated by the formation of disulfide bonds between the active site Cys-94 and Cys-131, and between Cys- 99 and Cys-104. Glutathione may be required to regulate its activity in the endoplasmic reticulum. Belongs to the EROs family.

Protein type: Oxidoreductase; EC 1.8.4.-; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 14q22.1

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen; intracellular membrane-bound organelle; membrane

Molecular Function: disulfide oxidoreductase activity; oxidoreductase activity; protein binding

Biological Process: chaperone cofactor-dependent protein folding; protein folding; protein modification process; release of sequestered calcium ion into cytosol; response to reactive oxygen species; response to temperature stimulus

Research Articles on ERO1L

Similar Products

Product Notes

The ERO1L ero1a (Catalog #AAA1273412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggccgcg gctggggatt cttgtttggc ctcctgggcg ccgtgtggct gctcagctcg ggccacggag aggagcagcc cccggagaca gcggcacaga ggtgcttctg ccaggttagt ggttacttgg atgattgtac ctgtgatgtt gaaaccattg atagatttaa taactacagg cttttcccaa gactacaaaa acttcttgaa agtgactact ttaggtatta caaggtaaac ctgaagaggc cgtgtccttt ctggaatgac atcagccagt gtggaagaag ggactgtgct gtcaaaccat gtcaatctga tgaagttcct gatggaatta aatctgcgag ctacaagtat tctgaagaag ccaataatct cattgaagaa tgtgaacaag ctgaacgact tggagcagtg gatgaatctc tgagtgagga aacacagaag gctgttcttc agtggaccaa gcatgatgat tcttcagata acttctgtga agctgatgac attcagtccc ctgaagctga atatgtagat ttgcttctta atcctgagcg ctacactggt tacaagggac cagatgcttg gaaaatatgg aatgtcatct acgaagaaaa ctgttttaag ccacagacaa ttaaaagacc tttaaatcct ttggcttctg gtcaagggac aagtgaagag aacacttttt acagttggct agaaggtctc tgtgtagaaa aaagagcatt ctacagactt atatctggcc tacatgcaag cattaatgtg catttgagtg caagatatct tttacaagag acctggttag aaaagaaatg gggacacaac attacagaat ttcaacagcg atttgatgga attttgactg aaggagaagg tccaagaagg cttaagaact tgtattttct ctacttaata gaactaaggg ctttatccaa agtgttacca ttcttcgagc gcccagattt tcaactcttt actggaaata aaattcagga tgaggaaaac aaaatgttac ttctggaaat acttcatgaa atcaagtcat ttcctttgca ttttgatgag aattcatttt ttgctgggga taaaaaagaa gcacacaaac taaaggagga ctttcgactg cattttagaa atatttcaag aattatggat tgtgttggtt gttttaaatg tcgtctgtgg ggaaagcttc agactcaggg tttgggcact gctctgaaga tcttattttc tgagaaattg atagcaaata tgccagaaag tggacctagt tatgaattcc atctaaccag acaagaaata gtatcattat tcaacgcatt tggaagaatt tctacaagtg tgaaagaatt agaaaacttc aggaacttgt tacagaatat tcattaa. It is sometimes possible for the material contained within the vial of "ERO1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.