Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERLIN1 cdna clone

ERLIN1 cDNA Clone

Gene Names
ERLIN1; KE04; KEO4; SPFH1; SPG62; Erlin-1; C10orf69
Synonyms
ERLIN1; ERLIN1 cDNA Clone; ERLIN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgactcaagcccgggttctggtggctgcagtggtggggttggtggctgtcctgctctacgcctccatccacaagattgaggagggccatctggctgtgtactacaggggaggagctttactaactagccccagtggaccaggctatcatatcatgttgcctttcattactacgttcagatctgtgcagacaacactacaaactgatgaagttaaaaatgtgccttgtggaacaagtggtggggtcatgatctatattgaccgaatagaagtggttaatatgttggctccttatgcagtgtttgatatcgtgaggaactatactgcagattatgacaagaccttaatcttcaataaaatccaccatgagctgaaccagttctgcagtgcccacacacttcaggaagtttacattgaattgtttgatcaaatagatgaaaacctgaagcaagctctgcagaaagacttaaacctcatggccccaggtctcactatacaggctgtgcgtgttacaaaacccaaaatcccagaagccataagaagaaattttgagttaatggaggctgagaagacaaaactccttatagctgcacagaaacaaaaggttgtggaaaaagaagctgagacagagaggaaaaaggcagttatagaagcagagaagattgcacaagtggcaaaaattcggtttcagcagaaagtgatggaaaaagaaactgaaaagcgcatttctgaaatcgaagatgctgcattcctggcccgagagaaagcgaaagcagatgctgaatattatgctgcacacaaatatgccacctcaaacaagcacaagttgaccccggaatatctggagctcaaaaagtaccaggccattgcttctaacagtaagatctattttggcagcaacatccctaacatgttcgtggactcctcatgtgctttgaaatattcagatattaggactggaagagaaagctcactcccctctaaggaggctcttgaaccctctggagagaacgtcatccaaaacaaagagagcacaggttga
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,926 Da
NCBI Official Full Name
Homo sapiens ER lipid raft associated 1, mRNA
NCBI Official Synonym Full Names
ER lipid raft associated 1
NCBI Official Symbol
ERLIN1
NCBI Official Synonym Symbols
KE04; KEO4; SPFH1; SPG62; Erlin-1; C10orf69
NCBI Protein Information
erlin-1
UniProt Protein Name
Erlin-1
Protein Family
UniProt Gene Name
ERLIN1
UniProt Synonym Gene Names
C10orf69; KE04; KEO4; SPFH1; SPFH domain-containing protein 1
UniProt Entry Name
ERLN1_HUMAN

Uniprot Description

SPFH1: Component of the ERLIN1/ERLIN2 complex which mediates the endoplasmic reticulum-associated degradation (ERAD) of inositol 1,4,5-trisphosphate receptors (IP3Rs). Belongs to the band 7/mec-2 family. Forms a heteromeric complex with ERLIN2.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 10q24.31

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; protein complex

Molecular Function: cholesterol binding; protein binding

Biological Process: ER-associated protein catabolic process; negative regulation of cholesterol biosynthetic process; negative regulation of fatty acid biosynthetic process; SREBP-mediated signaling pathway

Disease: Spastic Paraplegia 62, Autosomal Recessive

Research Articles on ERLIN1

Similar Products

Product Notes

The ERLIN1 erlin1 (Catalog #AAA1270727) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactcaag cccgggttct ggtggctgca gtggtggggt tggtggctgt cctgctctac gcctccatcc acaagattga ggagggccat ctggctgtgt actacagggg aggagcttta ctaactagcc ccagtggacc aggctatcat atcatgttgc ctttcattac tacgttcaga tctgtgcaga caacactaca aactgatgaa gttaaaaatg tgccttgtgg aacaagtggt ggggtcatga tctatattga ccgaatagaa gtggttaata tgttggctcc ttatgcagtg tttgatatcg tgaggaacta tactgcagat tatgacaaga ccttaatctt caataaaatc caccatgagc tgaaccagtt ctgcagtgcc cacacacttc aggaagttta cattgaattg tttgatcaaa tagatgaaaa cctgaagcaa gctctgcaga aagacttaaa cctcatggcc ccaggtctca ctatacaggc tgtgcgtgtt acaaaaccca aaatcccaga agccataaga agaaattttg agttaatgga ggctgagaag acaaaactcc ttatagctgc acagaaacaa aaggttgtgg aaaaagaagc tgagacagag aggaaaaagg cagttataga agcagagaag attgcacaag tggcaaaaat tcggtttcag cagaaagtga tggaaaaaga aactgaaaag cgcatttctg aaatcgaaga tgctgcattc ctggcccgag agaaagcgaa agcagatgct gaatattatg ctgcacacaa atatgccacc tcaaacaagc acaagttgac cccggaatat ctggagctca aaaagtacca ggccattgct tctaacagta agatctattt tggcagcaac atccctaaca tgttcgtgga ctcctcatgt gctttgaaat attcagatat taggactgga agagaaagct cactcccctc taaggaggct cttgaaccct ctggagagaa cgtcatccaa aacaaagaga gcacaggttg a. It is sometimes possible for the material contained within the vial of "ERLIN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.