EPS8L1 cdna clone
EPS8L1 cDNA Clone
Gene Names
EPS8L1; DRC3; EPS8R1; PP10566
Synonyms
EPS8L1; EPS8L1 cDNA Clone; EPS8L1 cdna clone
Sequence
atgaacagaacatggccaagaaggatctgggggagcagccaggacgaggcggagctgatccgagaggacatccagggggctctgcacaattaccgctcgggccgcggggagcgcagggcggcggcgctcagggccacgcaggaggagttgcagcgcgaccgctcgcccgccgctgagaccccgcccctgcagcgccgcccgtcagtccgcgcagtgatcagcaccgtagagcggggcgcgggccgcggacgaccccaggcgaagcccattcccgaggcagaggaggcgcagaggcctgagccggtggggacctcgagcaacgctgactcggcctccccggacctgggtccccggggtcctgacctggcggttctgcaggcggagcgggaagtggacatcctgaaccacgtgttcgacgacgtagagagctttgtatcgaggctgcagaagtcggcggaggcggccagggtgctggagcaccgggaacgcggccgcaggagccggcgccgggcggctggggagggcttgctgacgctgcgggccaagccgccctcggaggccgagtacaccgacgtgctgcagaagatcaagtacgccttcagcctgctggcccggctgcgcggcaacatcgccgacccctcctctccggagctgttgcacttccttttcgggcctctgcagatgattgtgaacacgtcgggggggccggagttcgcgagcagtgtgcggcggccgcatctgacatcggatgccgtggcgctgctgcgggacaacgtcactccacgtgaaaacgagctctggacctcgctgggggactcgtggacccgccccgggctggagctgtccccggaggagggacccccatacagacccgagttcttcagcggctgggagccgccggtcactgacccgcagagccgcgcctgggaggacccagttgagaaacagctacagcacgagcggaggcgccggcagcaaagcgccccccaggtcgctgtcaatggtcaccgagacttggagccagaatctgagcctcagctggagtcagagacagcaggaaaatgggtcctgtgtaattatgacttccaggcccgcaacagcagtgagctgtcggtcaagcagcgggacgtactggaggtcctggatgacagtcgtaagtggtggaaggttcgggacccagcggggcaggagggatatgtgccctacaacatcctgacaccctaccccggaccccggctgcaccacagccaaagccctgcccgcagcctgaacagcactcctcctccaccaccagccccagccccggccccacctccagctctggctcggccccgctgggacaggccccgctgggacagctgcgatagcctcaacggcttggaccccagcgagaaggagaaattctcccagatgctcatcgtcaacgaggaactgcaggcgcgcctggcccagggccgctcgggaccgagccgcgcagtcccagggccccgcgccccggaaccgcagctcagcccgggctcggacgcctccgaggtccgcgcctggctgcaggccaagggctttagctccgggaccgtggacgcgctgggtgtgctgaccggggcgcagcttttctcgctgcagaaggaggagctgcgggcggtgagccccgaggagggggcacgtgtgtacagccaggtcaccgtgcagcgctcgctgctggaggacaaagagaaagtgtcagagctggaggcagtgatggagaagcaaaagaagaaggtggaaggcgaggtggaaatggaggtcatttga
Sequence Length
1791
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,807 Da
NCBI Official Full Name
Homo sapiens EPS8-like 1, mRNA
NCBI Official Synonym Full Names
EPS8 like 1
NCBI Official Symbol
EPS8L1
NCBI Official Synonym Symbols
DRC3; EPS8R1; PP10566
NCBI Protein Information
epidermal growth factor receptor kinase substrate 8-like protein 1
UniProt Protein Name
Epidermal growth factor receptor kinase substrate 8-like protein 1
UniProt Gene Name
EPS8L1
UniProt Synonym Gene Names
DRC3; EPS8R1; EPS8-like protein 1; EPS8-related protein 1
UniProt Entry Name
ES8L1_HUMAN
NCBI Description
This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
EPS8L1: Stimulates guanine exchange activity of SOS1. May play a role in membrane ruffling and remodeling of the actin cytoskeleton. Belongs to the EPS8 family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 19q13.42
Cellular Component: cell-cell adherens junction; cytoplasm; protein complex
Molecular Function: actin binding; protein binding; Rac guanyl-nucleotide exchange factor activity; Rho guanyl-nucleotide exchange factor activity; T cell receptor binding
Biological Process: regulation of Rho protein signal transduction; Rho protein signal transduction
Similar Products
Product Notes
The EPS8L1 eps8l1 (Catalog #AAA1268339) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacagaa catggccaag aaggatctgg gggagcagcc aggacgaggc ggagctgatc cgagaggaca tccagggggc tctgcacaat taccgctcgg gccgcgggga gcgcagggcg gcggcgctca gggccacgca ggaggagttg cagcgcgacc gctcgcccgc cgctgagacc ccgcccctgc agcgccgccc gtcagtccgc gcagtgatca gcaccgtaga gcggggcgcg ggccgcggac gaccccaggc gaagcccatt cccgaggcag aggaggcgca gaggcctgag ccggtgggga cctcgagcaa cgctgactcg gcctccccgg acctgggtcc ccggggtcct gacctggcgg ttctgcaggc ggagcgggaa gtggacatcc tgaaccacgt gttcgacgac gtagagagct ttgtatcgag gctgcagaag tcggcggagg cggccagggt gctggagcac cgggaacgcg gccgcaggag ccggcgccgg gcggctgggg agggcttgct gacgctgcgg gccaagccgc cctcggaggc cgagtacacc gacgtgctgc agaagatcaa gtacgccttc agcctgctgg cccggctgcg cggcaacatc gccgacccct cctctccgga gctgttgcac ttccttttcg ggcctctgca gatgattgtg aacacgtcgg gggggccgga gttcgcgagc agtgtgcggc ggccgcatct gacatcggat gccgtggcgc tgctgcggga caacgtcact ccacgtgaaa acgagctctg gacctcgctg ggggactcgt ggacccgccc cgggctggag ctgtccccgg aggagggacc cccatacaga cccgagttct tcagcggctg ggagccgccg gtcactgacc cgcagagccg cgcctgggag gacccagttg agaaacagct acagcacgag cggaggcgcc ggcagcaaag cgccccccag gtcgctgtca atggtcaccg agacttggag ccagaatctg agcctcagct ggagtcagag acagcaggaa aatgggtcct gtgtaattat gacttccagg cccgcaacag cagtgagctg tcggtcaagc agcgggacgt actggaggtc ctggatgaca gtcgtaagtg gtggaaggtt cgggacccag cggggcagga gggatatgtg ccctacaaca tcctgacacc ctaccccgga ccccggctgc accacagcca aagccctgcc cgcagcctga acagcactcc tcctccacca ccagccccag ccccggcccc acctccagct ctggctcggc cccgctggga caggccccgc tgggacagct gcgatagcct caacggcttg gaccccagcg agaaggagaa attctcccag atgctcatcg tcaacgagga actgcaggcg cgcctggccc agggccgctc gggaccgagc cgcgcagtcc cagggccccg cgccccggaa ccgcagctca gcccgggctc ggacgcctcc gaggtccgcg cctggctgca ggccaagggc tttagctccg ggaccgtgga cgcgctgggt gtgctgaccg gggcgcagct tttctcgctg cagaaggagg agctgcgggc ggtgagcccc gaggaggggg cacgtgtgta cagccaggtc accgtgcagc gctcgctgct ggaggacaaa gagaaagtgt cagagctgga ggcagtgatg gagaagcaaa agaagaaggt ggaaggcgag gtggaaatgg aggtcatttg a. It is sometimes possible for the material contained within the vial of "EPS8L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
