Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EPHA8 cdna clone

EPHA8 cDNA Clone

Gene Names
EPHA8; EEK; EK3; HEK3
Synonyms
EPHA8; EPHA8 cDNA Clone; EPHA8 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccccgcccggggccgcctgccccctgcgctctgggtcgtcacggccgcggcggcggcggccacctgcgtgtccgcggcgcgcggcgaagtgaatttgctggacacgtcgaccatccacggggactggggctggctcacgtatccggctcatgggtgggactccatcaacgaggtggacgagtccttccagcccatccacacgtaccaggtttgcaacgtcatgagccccaaccagaacaactggctgcgcacgagctgggtcccccgagacggcgcccggcgcgtctatgctgagatcaagtttaccctgcgcgactgcaacagcatgcctggtgtgctgggcacctgcaaggagaccttcaacctctactacctggagtcggaccgcgacctgggggccagcacacaagaaagccagttcctcaaaatcgacaccattgcggccgacgagagcttcacaggtgccgaccttggtgtgcggcgtctcaagctcaacacggaggtgcgcagtgtgggtcccctcagcaagcgcggcttctacctggccttccaggacataggtgcctgcctggccatcctctctctccgcatctactataagaagtgccctgccatggtgcgcaatctggctgccttctcggaggcagtgacgggggccgactcgtcctcactggtggaggtgaggggccagtgcgtgcggcactcagaggagcgggacacacccaagatgtactgcagcgcggagggcgagtggctcgtgcccatcggcaaatgcgtgtgcagtgccggctacgaggagcggcgggatgcctgtgtggcctgtgagctgggcttctacaagtcagcccctggggaccagctgtgtgcccgctgccctccccacagccactccgcagctccagccgcccaagcctgccactgtgacctcagctactaccgtgcagccctggacccgccgtcctcagcctgcacccggccaccctcggcaccagtgaacctgatctccagtgtgaatgggacatcagtgactctggagtgggcccctcccctggacccaggtggccgcagtgacatcacctacaatgccgtgtgccgccgctgcccctgggcactgagccgctgcgaggcatgtgggagcggcacccgctttgtgccccagcagacaagcctggtgcaggccagcctgctggtggccaacctgctggcccacatgaactactccttctggatcgaggccgtcaatggcgtgtccgacctgagccccgagccccgccgggccgctgtggtcaacatcaccacgaaccaggcaggtaggcggagaaactccgtcccgcagcgtcctggtcccccagcttcccctgcctcagacccatccagggatcagagctctgccggggacgtgctgtgggcctttaggcaagtgcctctctggccctgcgctcctcaccaggacccagagctggaggctcttcattgcctttag
Sequence Length
1488
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,900 Da
NCBI Official Full Name
Homo sapiens EPH receptor A8, mRNA
NCBI Official Synonym Full Names
EPH receptor A8
NCBI Official Symbol
EPHA8
NCBI Official Synonym Symbols
EEK; EK3; HEK3
NCBI Protein Information
ephrin type-A receptor 8
UniProt Protein Name
Ephrin type-A receptor 8
Protein Family
UniProt Gene Name
EPHA8
UniProt Synonym Gene Names
EEK; HEK3; KIAA1459; EK3; hEK3
UniProt Entry Name
EPHA8_HUMAN

NCBI Description

This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]

Uniprot Description

EphA8: a receptor tyrosine kinase of the Eph family. A receptor for members of the ephrin-A family: ephrin A2, A3 and A5. Plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. The Eph receptor tyrosine kinase family, the largest in the tyrosine kinase group, has fourteen members. They bind membrane-anchored ligands, ephrins, at sites of cell-cell contact, regulating the repulsion and adhesion of cells that underlie the establishment, maintenance, and remodeling of patterns of cellular organization. Eph signals are particularly important in regulating cell adhesion and cell migration during development, axon guidance, homeostasis and disease. EphA receptors bind to GPI-anchored ephrin-A ligands, while EphB receptors bind to ephrin-B proteins that have a transmembrane and cytoplasmic domain. Interactions between EphB receptor kinases and ephrin-B proteins transduce signals bidirectionally, signaling to both interacting cell types. Eph receptors and ephrins also regulate the adhesion of endothelial cells and are required for the remodeling of blood vessels. Contains 1 sterile alpha motif (SAM) domain and 2 fibronectin type III domains.

Protein type: Membrane protein, integral; Protein kinase, TK; Kinase, protein; Protein kinase, tyrosine (receptor); EC 2.7.10.1; TK group; Eph family

Chromosomal Location of Human Ortholog: 1p36.12

Cellular Component: integral to plasma membrane; neuron projection; plasma membrane

Molecular Function: GPI-linked ephrin receptor activity

Biological Process: axon guidance; ephrin receptor signaling pathway; neurite development; neuron remodeling; positive regulation of MAPKKK cascade; positive regulation of phosphoinositide 3-kinase activity; protein amino acid autophosphorylation; regulation of cell adhesion; regulation of cell adhesion mediated by integrin; substrate-bound cell migration

Research Articles on EPHA8

Similar Products

Product Notes

The EPHA8 epha8 (Catalog #AAA1277017) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccccg cccggggccg cctgccccct gcgctctggg tcgtcacggc cgcggcggcg gcggccacct gcgtgtccgc ggcgcgcggc gaagtgaatt tgctggacac gtcgaccatc cacggggact ggggctggct cacgtatccg gctcatgggt gggactccat caacgaggtg gacgagtcct tccagcccat ccacacgtac caggtttgca acgtcatgag ccccaaccag aacaactggc tgcgcacgag ctgggtcccc cgagacggcg cccggcgcgt ctatgctgag atcaagttta ccctgcgcga ctgcaacagc atgcctggtg tgctgggcac ctgcaaggag accttcaacc tctactacct ggagtcggac cgcgacctgg gggccagcac acaagaaagc cagttcctca aaatcgacac cattgcggcc gacgagagct tcacaggtgc cgaccttggt gtgcggcgtc tcaagctcaa cacggaggtg cgcagtgtgg gtcccctcag caagcgcggc ttctacctgg ccttccagga cataggtgcc tgcctggcca tcctctctct ccgcatctac tataagaagt gccctgccat ggtgcgcaat ctggctgcct tctcggaggc agtgacgggg gccgactcgt cctcactggt ggaggtgagg ggccagtgcg tgcggcactc agaggagcgg gacacaccca agatgtactg cagcgcggag ggcgagtggc tcgtgcccat cggcaaatgc gtgtgcagtg ccggctacga ggagcggcgg gatgcctgtg tggcctgtga gctgggcttc tacaagtcag cccctgggga ccagctgtgt gcccgctgcc ctccccacag ccactccgca gctccagccg cccaagcctg ccactgtgac ctcagctact accgtgcagc cctggacccg ccgtcctcag cctgcacccg gccaccctcg gcaccagtga acctgatctc cagtgtgaat gggacatcag tgactctgga gtgggcccct cccctggacc caggtggccg cagtgacatc acctacaatg ccgtgtgccg ccgctgcccc tgggcactga gccgctgcga ggcatgtggg agcggcaccc gctttgtgcc ccagcagaca agcctggtgc aggccagcct gctggtggcc aacctgctgg cccacatgaa ctactccttc tggatcgagg ccgtcaatgg cgtgtccgac ctgagccccg agccccgccg ggccgctgtg gtcaacatca ccacgaacca ggcaggtagg cggagaaact ccgtcccgca gcgtcctggt cccccagctt cccctgcctc agacccatcc agggatcaga gctctgccgg ggacgtgctg tgggccttta ggcaagtgcc tctctggccc tgcgctcctc accaggaccc agagctggag gctcttcatt gcctttag. It is sometimes possible for the material contained within the vial of "EPHA8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.