ENPP5 cdna clone
ENPP5 cDNA Clone
Gene Names
ENPP5; NPP5; NPP-5
Synonyms
ENPP5; ENPP5 cDNA Clone; ENPP5 cdna clone
Sequence
atgacttcgaaatttctcttggtgtccttcatacttgctgcactgagtctttcaaccaccttttctctccaaccagaccagcaaaaggttctactagtttcttttgatggattccgttgggattacttatataaagttccaacgccccattttcattatattatgaaatatggtgttcacgtgaagcaagttactaatgtttttattacaaaaacctaccctaaccattatactttggtaactggcctctttgcagagaatcatgggattgttgcaaatgatatgtttgatcctattcggaacaaatctttctccttggatcacatgaatatttatgattccaagttttgggaagaagcgacaccaatatggatcacaaaccagagggcaggacatactagtggtgcagccatgtggcccggaacagatgtaaaaatacataagcgctttcctactcattacatgccttacaatgagtcagtttcatttgaagatagagttgccaaaattattgaatggtttacgtcaaaagagcccataaatcttggtcttctctattgggaagaccctgatgacatgggccaccatttgggacctgacagtccgctcatggggcctgtcatttcagatattgacaagaagttaggatatctcatacaaatgctgaaaaaggcaaagttgtggaacactctgaacctaatcatcacaagtgatcatggaatgacgcagtgctctgaggaaaggttaatagaacttgaccagtacctggataaagaccactataccctgattgatcaatctccagtagcagccatcttgccaaaagaaggtaaatttgatgaagtctatgaagcactaactcacgctcatcctaatcttactgtttacaaaaaagaagacgttccagaaaggtggcattacaaatacaacagtcgaattcaaccaatcatagcagtggctgatgaagggtggcacattttacagaataagtcagatgactttctgttaggcaaccacggttacgataatgcgttagcagatatgcatccaatatttttagcccatggtcctgccttcagaaagaatttctcaaaagaagccatgaactccacagatttgtacccactactatgccacctcctcaatatcaccgccatgccacacaatggatcattctggaatgtccaggatctgctcaattcagcaatgccaagggtggtcccttatacacagagtactatactcctccctggtagtgttaaaccagcagaatatgaccaagaggggtcatacccttatttcataggggtctctcttggcagcattatagtgattgtattttttgtaattttcattaagcatttaattcacagtcaaatacctgccttacaagatatgcatgctgaaatagctcaaccattattacaagcctaa
Sequence Length
1434
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,666 Da
NCBI Official Full Name
Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function), mRNA
NCBI Official Synonym Full Names
ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
NCBI Official Symbol
ENPP5
NCBI Official Synonym Symbols
NPP5; NPP-5
NCBI Protein Information
ectonucleotide pyrophosphatase/phosphodiesterase family member 5
UniProt Protein Name
Ectonucleotide pyrophosphatase/phosphodiesterase family member 5
Protein Family
UniProt Gene Name
ENPP5
UniProt Synonym Gene Names
E-NPP 5; NPP-5
UniProt Entry Name
ENPP5_HUMAN
NCBI Description
This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Uniprot Description
ENPP5: May play a role in neuronal cell communication. Lacks nucleotide pyrophosphatase and lysopholipase D activity. Belongs to the nucleotide pyrophosphatase/phosphodiesterase family.
Protein type: Hydrolase; EC 3.1.-.-; Membrane protein, integral; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 6p21.1-p11.2
Similar Products
Product Notes
The ENPP5 enpp5 (Catalog #AAA1270237) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacttcga aatttctctt ggtgtccttc atacttgctg cactgagtct ttcaaccacc ttttctctcc aaccagacca gcaaaaggtt ctactagttt cttttgatgg attccgttgg gattacttat ataaagttcc aacgccccat tttcattata ttatgaaata tggtgttcac gtgaagcaag ttactaatgt ttttattaca aaaacctacc ctaaccatta tactttggta actggcctct ttgcagagaa tcatgggatt gttgcaaatg atatgtttga tcctattcgg aacaaatctt tctccttgga tcacatgaat atttatgatt ccaagttttg ggaagaagcg acaccaatat ggatcacaaa ccagagggca ggacatacta gtggtgcagc catgtggccc ggaacagatg taaaaataca taagcgcttt cctactcatt acatgcctta caatgagtca gtttcatttg aagatagagt tgccaaaatt attgaatggt ttacgtcaaa agagcccata aatcttggtc ttctctattg ggaagaccct gatgacatgg gccaccattt gggacctgac agtccgctca tggggcctgt catttcagat attgacaaga agttaggata tctcatacaa atgctgaaaa aggcaaagtt gtggaacact ctgaacctaa tcatcacaag tgatcatgga atgacgcagt gctctgagga aaggttaata gaacttgacc agtacctgga taaagaccac tataccctga ttgatcaatc tccagtagca gccatcttgc caaaagaagg taaatttgat gaagtctatg aagcactaac tcacgctcat cctaatctta ctgtttacaa aaaagaagac gttccagaaa ggtggcatta caaatacaac agtcgaattc aaccaatcat agcagtggct gatgaagggt ggcacatttt acagaataag tcagatgact ttctgttagg caaccacggt tacgataatg cgttagcaga tatgcatcca atatttttag cccatggtcc tgccttcaga aagaatttct caaaagaagc catgaactcc acagatttgt acccactact atgccacctc ctcaatatca ccgccatgcc acacaatgga tcattctgga atgtccagga tctgctcaat tcagcaatgc caagggtggt cccttataca cagagtacta tactcctccc tggtagtgtt aaaccagcag aatatgacca agaggggtca tacccttatt tcataggggt ctctcttggc agcattatag tgattgtatt ttttgtaatt ttcattaagc atttaattca cagtcaaata cctgccttac aagatatgca tgctgaaata gctcaaccat tattacaagc ctaa. It is sometimes possible for the material contained within the vial of "ENPP5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
