Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ENPP2 cdna clone

ENPP2 cDNA Clone

Gene Names
ENPP2; ATX; NPP2; ATX-X; PDNP2; LysoPLD; AUTOTAXIN; PD-IALPHA
Synonyms
ENPP2; ENPP2 cDNA Clone; ENPP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaaggaggagctcgttccagtcgtgtcagataatatccctgttcacttttgccgttggagtcaatatctgcttaggattcactgcacatcgaattaagagagcagaaggatgggaggaaggtcctcctacagtgctatcagactccccctggaccaacatctccggatcttgcaagggcaggtgctttgaacttcaagaggctggacctcctgattgtcgctgtgacaacttgtgtaagagctataccagttgctgccatgactttgatgagctgtgtttgaagacagcccgtggctgggagtgtactaaggacagatgtggagaagtcagaaatgaagaaaatgcctgtcactgctcagaggactgcttggccaggggagactgctgtaccaattaccaagtggtttgcaaaggagagtcgcattgggttgatgatgactgtgaggaaataaaggccgcagaatgccctgcagggtttgttcgccctccattaatcatcttctccgtggatggcttccgtgcatcatacatgaagaaaggcagcaaagtcatgcctaatattgaaaaactaaggtcttgtggcacacactctccctacatgaggccggtgtacccaactaaaacctttcctaacttatacactttggccactgggctatatccagaatcacatggaattgttggcaattcaatgtatgatcctgtatttgatgccacttttcatctgcgagggcgagagaaatttaatcatagatggtggggaggtcaaccgctatggattacagccaccaagcaaggggtgaaagctggaacattcttttggtctgttgtcatccctcacgagcggagaatattaaccatattgcagtggctcaccctgccagatcatgagaggccttcggtctatgccttctattctgagcaacctgatttctctggacacaaatatggccctttcggccctgagatgacaaatcctctgagggaaatcgacaaaattgtggggcaattaatggatggactgaaacaactaaaactgcatcggtgtgtcaacgtcatctttgtcggagaccatggaatggaagatgtcacatgtgatagaactgagttcttgagtaattacctaactaatgtggatgatattactttagtgcctggaactctaggaagaattcgatccaaatttagcaacaatgctaaatatgaccccaaagccattattgccaatctcacgtgtaaaaaaccagatcagcactttaagccttacttgaaacagcaccttcccaaacgtttgcactatgccaacaacagaagaattgaggatatccatttattggtggaacgcagatggcatgttgcaaggaaacctttggatgtttataagaaaccatcaggaaaatgctttttccagggagaccacggatttgataacaaggtcaacagcatgcagactgtttttgtaggttatggcccaacatttaagtacaagactaaagtgcctccatttgaaaacattgaactttacaatgttatgtgtgatctcctgggattgaagccagctcctaataatgggacccatggaagtttgaatcatctcctgcgcactaataccttcaggccaaccatgccagaggaagttaccagacccaattatccagggattatgtaccttcagtctgattttgacctgggctgcacttgtgatgataaggtagagccaaagaacaagttggatgaactcaacaaacggcttcatacaaaagggtctacagaagagagacacctcctctatgggcgacctgcagtgctttatcggactagatatgatatcttatatcacactgactttgaaagtggttatagtgaaatattcctaatgccactctggacatcatatactgtttccaaacaggctgaggtttccagcgttcctgaccatctgaccagttgcgtccggcctgatgtccgtgtttctccgagtttcagtcagaactgtttggcctacaaaaatgataagcagatgtcctacggattcctctttcctccttatctgagctcttcaccagaggctaaatatgatgcattccttgtaaccaatatggttccaatgtatcctgctttcaaacgggtctggaattatttccaaagggtattggtgaagaaatatgcttcggaaagaaatggagttaacgtgataagtggaccaatcttcgactatgactatgatggcttacatgacacagaagacaaaataaaacagtacgtggaaggcagttccattcctgttccaactcactactacagcatcatcaccagctgtctggatttcactcagcctgccgacaagtgtgacggccctctctctgtgtcctccttcatcctgcctcaccggcctgacaacgaggagagctgcaatagctcagaggacgaatcaaaatgggtagaagaactcatgaagatgcacacagctagggtgcgtgacattgaacatctcaccagcctggacttcttccgaaagaccagccgcagctacccagaaatcctgacactcaagacatacctgcatacatatgagagcgagatttaa
Sequence Length
2592
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
101,968 Da
NCBI Official Full Name
Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2, mRNA
NCBI Official Synonym Full Names
ectonucleotide pyrophosphatase/phosphodiesterase 2
NCBI Official Symbol
ENPP2
NCBI Official Synonym Symbols
ATX; NPP2; ATX-X; PDNP2; LysoPLD; AUTOTAXIN; PD-IALPHA
NCBI Protein Information
ectonucleotide pyrophosphatase/phosphodiesterase family member 2
UniProt Protein Name
Ectonucleotide pyrophosphatase/phosphodiesterase family member 2
UniProt Gene Name
ENPP2
UniProt Synonym Gene Names
ATX; PDNP2; E-NPP 2; LysoPLD
UniProt Entry Name
ENPP2_HUMAN

NCBI Description

The protein encoded by this gene functions as both a phosphodiesterase, which cleaves phosphodiester bonds at the 5' end of oligonucleotides, and a phospholipase, which catalyzes production of lysophosphatidic acid (LPA) in extracellular fluids. LPA evokes growth factor-like responses including stimulation of cell proliferation and chemotaxis. This gene product stimulates the motility of tumor cells and has angiogenic properties, and its expression is upregulated in several kinds of carcinomas. The gene product is secreted and further processed to make the biologically active form. Several alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2008]

Uniprot Description

ENPP2: Hydrolyzes lysophospholipids to produce lysophosphatidic acid (LPA) in extracellular fluids. Major substrate is lysophosphatidylcholine. Also can act on sphingosylphosphphorylcholine producing sphingosine-1-phosphate, a modulator of cell motility. Can hydrolyze, in vitro, bis-pNPP, to some extent pNP-TMP, and barely ATP. Involved in several motility- related processes such as angiogenesis and neurite outgrowth. Acts as an angiogenic factor by stimulating migration of smooth muscle cells and microtubule formation. Stimulates migration of melanoma cells, probably via a pertussis toxin-sensitive G protein. May have a role in induction of parturition. Possible involvement in cell proliferation and adipose tissue development. Tumor cell motility-stimulating factor. Belongs to the nucleotide pyrophosphatase/phosphodiesterase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Phosphodiesterase; Lipid Metabolism - ether lipid; Secreted, signal peptide; EC 3.1.4.39; Motility/polarity/chemotaxis; Secreted

Chromosomal Location of Human Ortholog: 8q24.1

Cellular Component: extracellular space; integral to plasma membrane; plasma membrane

Molecular Function: calcium ion binding; hydrolase activity; lysophospholipase activity; transcription factor binding; zinc ion binding

Biological Process: cell motility; G-protein coupled receptor protein signaling pathway; phosphate metabolic process; phospholipid catabolic process; positive regulation of peptidyl-tyrosine phosphorylation; regulation of cell migration

Research Articles on ENPP2

Similar Products

Product Notes

The ENPP2 enpp2 (Catalog #AAA1265792) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaagga ggagctcgtt ccagtcgtgt cagataatat ccctgttcac ttttgccgtt ggagtcaata tctgcttagg attcactgca catcgaatta agagagcaga aggatgggag gaaggtcctc ctacagtgct atcagactcc ccctggacca acatctccgg atcttgcaag ggcaggtgct ttgaacttca agaggctgga cctcctgatt gtcgctgtga caacttgtgt aagagctata ccagttgctg ccatgacttt gatgagctgt gtttgaagac agcccgtggc tgggagtgta ctaaggacag atgtggagaa gtcagaaatg aagaaaatgc ctgtcactgc tcagaggact gcttggccag gggagactgc tgtaccaatt accaagtggt ttgcaaagga gagtcgcatt gggttgatga tgactgtgag gaaataaagg ccgcagaatg ccctgcaggg tttgttcgcc ctccattaat catcttctcc gtggatggct tccgtgcatc atacatgaag aaaggcagca aagtcatgcc taatattgaa aaactaaggt cttgtggcac acactctccc tacatgaggc cggtgtaccc aactaaaacc tttcctaact tatacacttt ggccactggg ctatatccag aatcacatgg aattgttggc aattcaatgt atgatcctgt atttgatgcc acttttcatc tgcgagggcg agagaaattt aatcatagat ggtggggagg tcaaccgcta tggattacag ccaccaagca aggggtgaaa gctggaacat tcttttggtc tgttgtcatc cctcacgagc ggagaatatt aaccatattg cagtggctca ccctgccaga tcatgagagg ccttcggtct atgccttcta ttctgagcaa cctgatttct ctggacacaa atatggccct ttcggccctg agatgacaaa tcctctgagg gaaatcgaca aaattgtggg gcaattaatg gatggactga aacaactaaa actgcatcgg tgtgtcaacg tcatctttgt cggagaccat ggaatggaag atgtcacatg tgatagaact gagttcttga gtaattacct aactaatgtg gatgatatta ctttagtgcc tggaactcta ggaagaattc gatccaaatt tagcaacaat gctaaatatg accccaaagc cattattgcc aatctcacgt gtaaaaaacc agatcagcac tttaagcctt acttgaaaca gcaccttccc aaacgtttgc actatgccaa caacagaaga attgaggata tccatttatt ggtggaacgc agatggcatg ttgcaaggaa acctttggat gtttataaga aaccatcagg aaaatgcttt ttccagggag accacggatt tgataacaag gtcaacagca tgcagactgt ttttgtaggt tatggcccaa catttaagta caagactaaa gtgcctccat ttgaaaacat tgaactttac aatgttatgt gtgatctcct gggattgaag ccagctccta ataatgggac ccatggaagt ttgaatcatc tcctgcgcac taataccttc aggccaacca tgccagagga agttaccaga cccaattatc cagggattat gtaccttcag tctgattttg acctgggctg cacttgtgat gataaggtag agccaaagaa caagttggat gaactcaaca aacggcttca tacaaaaggg tctacagaag agagacacct cctctatggg cgacctgcag tgctttatcg gactagatat gatatcttat atcacactga ctttgaaagt ggttatagtg aaatattcct aatgccactc tggacatcat atactgtttc caaacaggct gaggtttcca gcgttcctga ccatctgacc agttgcgtcc ggcctgatgt ccgtgtttct ccgagtttca gtcagaactg tttggcctac aaaaatgata agcagatgtc ctacggattc ctctttcctc cttatctgag ctcttcacca gaggctaaat atgatgcatt ccttgtaacc aatatggttc caatgtatcc tgctttcaaa cgggtctgga attatttcca aagggtattg gtgaagaaat atgcttcgga aagaaatgga gttaacgtga taagtggacc aatcttcgac tatgactatg atggcttaca tgacacagaa gacaaaataa aacagtacgt ggaaggcagt tccattcctg ttccaactca ctactacagc atcatcacca gctgtctgga tttcactcag cctgccgaca agtgtgacgg ccctctctct gtgtcctcct tcatcctgcc tcaccggcct gacaacgagg agagctgcaa tagctcagag gacgaatcaa aatgggtaga agaactcatg aagatgcaca cagctagggt gcgtgacatt gaacatctca ccagcctgga cttcttccga aagaccagcc gcagctaccc agaaatcctg acactcaaga catacctgca tacatatgag agcgagattt aa. It is sometimes possible for the material contained within the vial of "ENPP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.