Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ELSPBP1 cdna clone

ELSPBP1 cDNA Clone

Gene Names
ELSPBP1; E12; HE12; EL149; EDDM12
Synonyms
ELSPBP1; ELSPBP1 cDNA Clone; ELSPBP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgacccgatggtccagttacctgttgggatggacaaccttccttctctattcctatgagtcaagtggagggatgcatgaggaatgtgtctttcctttcacctacaagggatctgtttacttcacttgcacccatattcatagcttatccccttggtgtgccaccagagccgtgtacaacggccagtggaagtactgccagagtgaagattacccacgctgtatcttccctttcatctatcgaggaaaggcttataacagctgcatctcccagggcagcttcttaggcagtctgtggtgctcagtcacctctgtcttcgatgagaaacagcagtggaaattctgtgaaacgaatgagtatgggggaaattctctcaggaagccctgcatcttcccctccatctacagaaataatgtggtctctgattgcatggaggatgaaagcaacaagctctggtgcccaaccacagagaacatggataaggatggaaagtggagtttctgtgccgacaccagaatttccgcgttggtccctggctttccttgtcactttccgttcaactataaaaacaagaattattttaactgcactaacaaaggatcaaaggagaaccttgtgtggtgtgcaacttcttacaactacgaccaagaccacacctgggtgtattgctga
Sequence Length
672
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,106 Da
NCBI Official Full Name
Homo sapiens epididymal sperm binding protein 1, mRNA
NCBI Official Synonym Full Names
epididymal sperm binding protein 1
NCBI Official Symbol
ELSPBP1
NCBI Official Synonym Symbols
E12; HE12; EL149; EDDM12
NCBI Protein Information
epididymal sperm-binding protein 1
UniProt Protein Name
Epididymal sperm-binding protein 1
UniProt Gene Name
ELSPBP1
UniProt Synonym Gene Names
E12; hE12
UniProt Entry Name
ESPB1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the sperm-coating protein family of epididymal origin. This protein and its canine homolog are the first known examples of proteins with four tandemly arranged fibronectin type 2 (Fn2) domains in the Fn2-module protein family. [provided by RefSeq, Jul 2008]

Uniprot Description

ELSPBP1: Binds to spermatozoa upon ejaculation and may play a role in sperm capacitation. Has phosphorylcholine-binding activity. Belongs to the seminal plasma protein family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 19q13.33

Research Articles on ELSPBP1

Similar Products

Product Notes

The ELSPBP1 elspbp1 (Catalog #AAA1266150) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacccgat ggtccagtta cctgttggga tggacaacct tccttctcta ttcctatgag tcaagtggag ggatgcatga ggaatgtgtc tttcctttca cctacaaggg atctgtttac ttcacttgca cccatattca tagcttatcc ccttggtgtg ccaccagagc cgtgtacaac ggccagtgga agtactgcca gagtgaagat tacccacgct gtatcttccc tttcatctat cgaggaaagg cttataacag ctgcatctcc cagggcagct tcttaggcag tctgtggtgc tcagtcacct ctgtcttcga tgagaaacag cagtggaaat tctgtgaaac gaatgagtat gggggaaatt ctctcaggaa gccctgcatc ttcccctcca tctacagaaa taatgtggtc tctgattgca tggaggatga aagcaacaag ctctggtgcc caaccacaga gaacatggat aaggatggaa agtggagttt ctgtgccgac accagaattt ccgcgttggt ccctggcttt ccttgtcact ttccgttcaa ctataaaaac aagaattatt ttaactgcac taacaaagga tcaaaggaga accttgtgtg gtgtgcaact tcttacaact acgaccaaga ccacacctgg gtgtattgct ga. It is sometimes possible for the material contained within the vial of "ELSPBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.