Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF6 cdna clone

EIF6 cDNA Clone

Gene Names
EIF6; CAB; EIF3A; eIF-6; p27BBP; ITGB4BP; b(2)gcn; p27(BBP)
Synonyms
EIF6; EIF6 cDNA Clone; EIF6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtccgagcttcgttcgagaacaactgtgagatcggctgctttgccaagctcaccaacacctactgtctggtagcgatcggaggctcagagaacttctacagtgtgttcgagggcgagctctccgataccatccccgtggtgcacgcgtctatcgccggctgccgcatcatcgggcgcatgtgtgtggggaacaggcacggtctcctggtacccaacaataccaccgaccaggagctgcaacacattcgcaacagcctcccagacacagtgcagattaggcgggtggaggagcggctctcagccttgggcaatgtcaccacctgcaatgactacgtggccttggtccacccagacttggacagggagacagaagaaattctggcagatgtgctcaaggtggaagtcttcagacagacagtggccgaccaggtgctagtaggaagctactgtgtcttcagcaatcagggagggctggtgcatcccaagacttcaattgaagaccaggatgagctgtcctctcttcttcaagtcccccttgtggcggggactgtgaaccgaggcagtgaggtgattgctgctgggatggtggtgaatgactggtgtgccttctgtggcctggacacaaccagcacagagctgtcagtggtggagagtgtcttcaagctgaatgaagcccagcctagcaccattgccaccagcatgcgggattccctcattgacagcctcacctga
Sequence Length
738
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,735 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 6, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 6
NCBI Official Symbol
EIF6
NCBI Official Synonym Symbols
CAB; EIF3A; eIF-6; p27BBP; ITGB4BP; b(2)gcn; p27(BBP)
NCBI Protein Information
eukaryotic translation initiation factor 6
UniProt Protein Name
Eukaryotic translation initiation factor 6
UniProt Gene Name
EIF6
UniProt Synonym Gene Names
eIF-6
UniProt Entry Name
IF6_HUMAN

NCBI Description

Hemidesmosomes are structures which link the basal lamina to the intermediate filament cytoskeleton. An important functional component of hemidesmosomes is the integrin beta-4 subunit (ITGB4), a protein containing two fibronectin type III domains. The protein encoded by this gene binds to the fibronectin type III domains of ITGB4 and may help link ITGB4 to the intermediate filament cytoskeleton. The encoded protein, which is insoluble and found both in the nucleus and in the cytoplasm, can function as a translation initiation factor and prevent the association of the 40S and 60S ribosomal subunits. Multiple non-protein coding transcript variants and variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]

Uniprot Description

EIF6: eukaryotic translation initiation factor 6. Binds to the 60S ribosomal subunit and prevents its association with the 40S ribosomal subunit to form the 80S initiation complex.

Protein type: Translation initiation; Translation; Nucleolus

Chromosomal Location of Human Ortholog: 20q12

Cellular Component: cytoplasm; cytosol; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding; ribosomal large subunit binding; ribosome binding

Biological Process: maturation of 5.8S rRNA; maturation of LSU-rRNA; mature ribosome assembly; miRNA-mediated gene silencing; miRNA-mediated gene silencing, negative regulation of translation; positive regulation of translation; regulation of fatty acid biosynthetic process; regulation of glycolysis; regulation of megakaryocyte differentiation; response to insulin stimulus; ribosome export from nucleus

Research Articles on EIF6

Similar Products

Product Notes

The EIF6 eif6 (Catalog #AAA1273884) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtcc gagcttcgtt cgagaacaac tgtgagatcg gctgctttgc caagctcacc aacacctact gtctggtagc gatcggaggc tcagagaact tctacagtgt gttcgagggc gagctctccg ataccatccc cgtggtgcac gcgtctatcg ccggctgccg catcatcggg cgcatgtgtg tggggaacag gcacggtctc ctggtaccca acaataccac cgaccaggag ctgcaacaca ttcgcaacag cctcccagac acagtgcaga ttaggcgggt ggaggagcgg ctctcagcct tgggcaatgt caccacctgc aatgactacg tggccttggt ccacccagac ttggacaggg agacagaaga aattctggca gatgtgctca aggtggaagt cttcagacag acagtggccg accaggtgct agtaggaagc tactgtgtct tcagcaatca gggagggctg gtgcatccca agacttcaat tgaagaccag gatgagctgt cctctcttct tcaagtcccc cttgtggcgg ggactgtgaa ccgaggcagt gaggtgattg ctgctgggat ggtggtgaat gactggtgtg ccttctgtgg cctggacaca accagcacag agctgtcagt ggtggagagt gtcttcaagc tgaatgaagc ccagcctagc accattgcca ccagcatgcg ggattccctc attgacagcc tcacctga. It is sometimes possible for the material contained within the vial of "EIF6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.