Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Map

EIF4H cdna clone

EIF4H cDNA Clone

Gene Names
EIF4H; WSCR1; WBSCR1; eIF-4H
Synonyms
EIF4H; EIF4H cDNA Clone; KIAA0038; WSCR1; EIF4H cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCGGACTTCGACACCTACGACGATCGGGCCTACAGCAGCTTCGGCGGCGGCAGAGGGTCCCGCGGCAGTGCTGGTGGCCATGGTTCCCGTAGCCAGAAGGAGTTGCCCACAGAGCCCCCCTACACAGCATACGTAGGAAATCTACCTTTCAATACGGTTCAGGGCGACATAGATGCTATCTTTAAGGATCTCAGCATAAGGAGTGTACGGCTAGTCAGAGACAAAGACACAGATAAATTTAAAGGATTCTGCTATGTAGAATTCGATGAAGTGGATTCCCTTAAGGAAGCCTTGACATACGATGGTGCACTGTTGGGCGATCGGTCACTTCGTGTGGACATTGCAGAAGGCAGAAAACAAGATAAAGGTGGCTTTGGATTCAGAAAAGGTGGACCAGATGACAGAGGCTTCAGGGATGACTTCTTAGGGGGCAGGGGAGGTAGTCGCCCAGGCGACCGGCGAACAGGCCCCCCCATGGGCAGCCGCTTCAGAGATGGCCCTCCCCTCCGTGGATCCAACATGGATTTCAGAGAACCCACAGAAGAGGAAAGAGCACAGAGACCACGACTCCAGCTTAAACCTCGAACAGTCGCGACGCCCCTCAATCAAGTAGCCAATCCCAACTCTGCTATCTTCGGGGGTGCCAGGCCTAGAGAGGAAGTCGTTCAAAAGGAGCAAGAATGA
Sequence Length
687
Vector
pENTR223.1?spectinomycin?
cDNA Size
687 bp
Clone Sequence Report
Provided with product shipment

Map

Map
Related Product Information for EIF4H cdna clone
Homo sapiens eukaryotic translation initiation factor 4H, mRNA (cDNA clone MGC:12890 IMA GE:4139578), complete cds.

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 4H, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 4H
NCBI Official Symbol
EIF4H
NCBI Official Synonym Symbols
WSCR1; WBSCR1; eIF-4H
NCBI Protein Information
eukaryotic translation initiation factor 4H
UniProt Protein Name
Eukaryotic translation initiation factor 4H
UniProt Gene Name
EIF4H
UniProt Synonym Gene Names
KIAA0038; WBSCR1; WSCR1; eIF-4H
UniProt Entry Name
IF4H_HUMAN

NCBI Description

This gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]

Uniprot Description

EIF4H: eukaryotic translation initiation factor 4H stimulates protein translation. May stimulate the activities of EIF4A, EIF4B and EIF4F during the steps involving mRNA binding and utilization in the initiation of protein biosynthesis. Binds mRNA. Two alternatively spliced isoforms have been described. The short isoform is the predominant isoform and is expressed alone in liver and skeletal muscle. Both isoforms are expressed in fibroblast, spleen, testis and bone marrow. Levels are high in lung and pancreas and low in heart, frontal cortex and kidney.

Protein type: Translation initiation; RNA-binding; Translation

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: cell-cell adherens junction; cytosol; eukaryotic translation initiation factor 4F complex; membrane; polysome

Molecular Function: helicase activity; protein binding; ribosomal small subunit binding; RNA binding; RNA strand annealing activity; RNA strand-exchange activity; translation factor activity, nucleic acid binding

Biological Process: formation of translation preinitiation complex; regulation of translational initiation; translational initiation

Disease: Williams-beuren Syndrome

Research Articles on EIF4H

Similar Products

Product Notes

The EIF4H eif4h (Catalog #AAA1274353) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCGGACT TCGACACCTA CGACGATCGG GCCTACAGCA GCTTCGGCGG CGGCAGAGGG TCCCGCGGCA GTGCTGGTGG CCATGGTTCC CGTAGCCAGA AGGAGTTGCC CACAGAGCCC CCCTACACAG CATACGTAGG AAATCTACCT TTCAATACGG TTCAGGGCGA CATAGATGCT ATCTTTAAGG ATCTCAGCAT AAGGAGTGTA CGGCTAGTCA GAGACAAAGA CACAGATAAA TTTAAAGGAT TCTGCTATGT AGAATTCGAT GAAGTGGATT CCCTTAAGGA AGCCTTGACA TACGATGGTG CACTGTTGGG CGATCGGTCA CTTCGTGTGG ACATTGCAGA AGGCAGAAAA CAAGATAAAG GTGGCTTTGG ATTCAGAAAA GGTGGACCAG ATGACAGAGG CTTCAGGGAT GACTTCTTAG GGGGCAGGGG AGGTAGTCGC CCAGGCGACC GGCGAACAGG CCCCCCCATG GGCAGCCGCT TCAGAGATGG CCCTCCCCTC CGTGGATCCA ACATGGATTT CAGAGAACCC ACAGAAGAGG AAAGAGCACA GAGACCACGA CTCCAGCTTA AACCTCGAAC AGTCGCGACG CCCCTCAATC AAGTAGCCAA TCCCAACTCT GCTATCTTCG GGGGTGCCAG GCCTAGAGAG GAAGTCGTTC AAAAGGAGCA AGAATGA. It is sometimes possible for the material contained within the vial of "EIF4H, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.