Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF3C cdna clone

EIF3C cDNA Clone

Gene Names
EIF3C; EIF3CL; EIF3S8; eIF3-p110
Synonyms
EIF3C; EIF3C cDNA Clone; EIF3C cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgcggtttttcaccaccggttcggacagcgagtccgagtcgtccttgtccggggaggagctcgtcaccaaacctgtcggaggcaactatggcaaacagccattgttgctgagcgaggatgaagaagataccaagagagttgtccgcagtgccaaggacaagaggtttgaggagctgaccaaccttatccggaccatccgtaatgccatgaagattcgtgatgtcaccaagtgcctggaagagtttgagctcctgggaaaagcatatgggaaggccaaaagcattgtggacaaagaaggtgtcccccggttctatatccgcatcctggctgacctagaggactatcttaatgagctttgggaagataaggaagggaagaagaagatgaacaagaacaatgccaaggctctgagcaccttgcgtcagaagatccgaaaatacaaccgtgatttcgagtcccatatcacaagctacaagcagaaccccgagcagtctgcggatgaagatgctgagaaaaatgaggaggattcagaaggctcttcagatgaggatgaggatgaggacggagtcagtgctgcaactttcttgaagaagaaatcagaagctccttctggggagagtcgcaagttcctcaaaaagatggatgatgaagatgaggactcagaagattccgaagatgatgaagactgggacacaggttccacatcttccgattccgactcagaggaggaagaagggaaacaaaccgcgctggcctcaagatttcttaaaaaggcacccaccacagatgaggacaagaaggcagccgagaagaaacgggaggacaaagctaagaagaagcacgacaggaaatccaagcgcctggatgaggaggaggaggacaatgaaggcggggagtgggaaagggtccggggcggagtgccgttggttaaggagaagccaaaaatgtttgccaagggaactgagatcacccatgctgttgttatcaagaaactgaatgagatcctacaggcacgaggcaagaagggaactgatcgtgctgcccagattgagctgctgcaactgctggttcagattgcagcggaaaacaacctgggagagggcgtcattgtcaagatcaagttcaatatcatcgcctctctctatgactacaaccccaacctggcaacctacatgaagccagagatgtgggggaagtgcctggactgcatcaatgagctgatggatatcctgtttgcaaatcccaacatttttgttggagagaatattctggaagagagtgagaacctgcacaacgctgaccagccactgcgtgtccgtggctgcatcctaactctggtggaacgaatggatgaagaatttaccaaaataatgcaaaatactgaccctcactcccaagagtacgtggagcacttgaaggatgaggcccaggtgtgtgccatcatcgagcgtgtgcagcgctacctggaggagaagggcactaccgaggaggtctgccgcatctacctgctgcgcatcctgcacacctactacaagtttgattacaaggcccatcagcgacagctgaccccgcctgagggctcctcaaagtctgagcaagaccaggcagaaaatgagggcgaggactcggctgtgttgatggagagactgtgcaagtacatctacgccaaggaccgcacagaccggatccgcacatgtgccatcctctgccacatctaccaccatgctctgcactcgcgctggtaccaggcccgcgacctcatgctcatgagccacttgcaggacaacattcagcatgcagacccgccagtgcagatcctttacaaccgcaccatggtgcagctgggcatctgtgccttccgccaaggcctgaccaaggacgcacacaacgccctgctggacatccagtcgagtggccgagccaaggagcttctgggccagggcctgctgctgcgcagcctgcaggagcgcaaccaggagcaggagaaggtggagcggcgccgtcaggtccccttccacctgcacatcaacctggagctgctggagtgtgtctacctggtgtctgccatgctcctggagatcccctacatggccgcccatgagagcgatgcccgccgacgcatgatcagcaagcagttccaccaccagctgcgcgtgggcgagcgacagcccctgctgggtccccctgagtccatgcgggaacatgtggtcgctgcctccaaggccatgaagatgggtgactggaagacctgtcacagttttatcatcaatgagaagatgaatgggaaagtgtgggaccttttccccgaggctgacaaagtccgcaccatgctggttaggaagatccaggaagagtcactgaggacctacctcttcacctacagcagtgtctatgactccatcagcatggagacgctgtcagacatgtttgagctggatctgcccactgtgcactccatcatcagcaaaatgatcattaatgaggagctgatggcctccctggaccagccaacacagacagtggtgatgcaccgcactgagcccactgcccagcagaacctggctctgcagctggccgagaagctgggcagcctggtggagaacaacgaacgggtgtttgaccacaagcagggcacctacgggggctacttccgagaccagaaggacggctaccgcaaaaacgagggctacatgcgccgcggtggctaccgccagcagcagtctcagacggcctactga
Sequence Length
2742
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
104,101 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 3, subunit C, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 3 subunit C
NCBI Official Symbol
EIF3C
NCBI Official Synonym Symbols
EIF3CL; EIF3S8; eIF3-p110
NCBI Protein Information
eukaryotic translation initiation factor 3 subunit C
UniProt Protein Name
Eukaryotic translation initiation factor 3 subunit C
UniProt Gene Name
EIF3C
UniProt Synonym Gene Names
eIF3c
UniProt Entry Name
EIF3C_HUMAN

Uniprot Description

EIF3C: Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of posttermination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is composed of 13 subunits: EIF3A, EIF3B, EIF3C, EIF3D, EIF3E, EIF3F, EIF3G, EIF3H, EIF3I, EIF3J, EIF3K, EIF3L and EIF3M. The eIF-3 complex appears to include 3 stable modules: module A is composed of EIF3A, EIF3B, EIF3G and EIF3I; module B is composed of EIF3F, EIF3H, and EIF3M; and module C is composed of EIF3C, EIF3D, EIF3E, EIF3K and EIF3L. EIF3C of module C binds EIF3B of module A and EIF3H of module B, thereby linking the three modules. EIF3J is a labile subunit that binds to the eIF-3 complex via EIF3B. The eIF-3 complex interacts with RPS6KB1 under conditions of nutrient depletion. Mitogenic stimulation leads to binding and activation of a complex composed of MTOR and RPTOR, leading to phosphorylation and release of RPS6KB1 and binding of EIF4B to eIF-3. Identified in a HCV IRES-mediated translation complex, at least composed of EIF3C, IGF2BP1, RPS3 and HCV RNA-replicon. Belongs to the eIF-3 subunit C family.

Protein type: Translation; Translation initiation; RNA-binding

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: cytosol; eukaryotic translation initiation factor 3 complex

Molecular Function: protein binding; translation initiation factor activity; translation initiation factor binding

Biological Process: translational initiation

Research Articles on EIF3C

Similar Products

Product Notes

The EIF3C eif3c (Catalog #AAA1266811) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgcggt ttttcaccac cggttcggac agcgagtccg agtcgtcctt gtccggggag gagctcgtca ccaaacctgt cggaggcaac tatggcaaac agccattgtt gctgagcgag gatgaagaag ataccaagag agttgtccgc agtgccaagg acaagaggtt tgaggagctg accaacctta tccggaccat ccgtaatgcc atgaagattc gtgatgtcac caagtgcctg gaagagtttg agctcctggg aaaagcatat gggaaggcca aaagcattgt ggacaaagaa ggtgtccccc ggttctatat ccgcatcctg gctgacctag aggactatct taatgagctt tgggaagata aggaagggaa gaagaagatg aacaagaaca atgccaaggc tctgagcacc ttgcgtcaga agatccgaaa atacaaccgt gatttcgagt cccatatcac aagctacaag cagaaccccg agcagtctgc ggatgaagat gctgagaaaa atgaggagga ttcagaaggc tcttcagatg aggatgagga tgaggacgga gtcagtgctg caactttctt gaagaagaaa tcagaagctc cttctgggga gagtcgcaag ttcctcaaaa agatggatga tgaagatgag gactcagaag attccgaaga tgatgaagac tgggacacag gttccacatc ttccgattcc gactcagagg aggaagaagg gaaacaaacc gcgctggcct caagatttct taaaaaggca cccaccacag atgaggacaa gaaggcagcc gagaagaaac gggaggacaa agctaagaag aagcacgaca ggaaatccaa gcgcctggat gaggaggagg aggacaatga aggcggggag tgggaaaggg tccggggcgg agtgccgttg gttaaggaga agccaaaaat gtttgccaag ggaactgaga tcacccatgc tgttgttatc aagaaactga atgagatcct acaggcacga ggcaagaagg gaactgatcg tgctgcccag attgagctgc tgcaactgct ggttcagatt gcagcggaaa acaacctggg agagggcgtc attgtcaaga tcaagttcaa tatcatcgcc tctctctatg actacaaccc caacctggca acctacatga agccagagat gtgggggaag tgcctggact gcatcaatga gctgatggat atcctgtttg caaatcccaa catttttgtt ggagagaata ttctggaaga gagtgagaac ctgcacaacg ctgaccagcc actgcgtgtc cgtggctgca tcctaactct ggtggaacga atggatgaag aatttaccaa aataatgcaa aatactgacc ctcactccca agagtacgtg gagcacttga aggatgaggc ccaggtgtgt gccatcatcg agcgtgtgca gcgctacctg gaggagaagg gcactaccga ggaggtctgc cgcatctacc tgctgcgcat cctgcacacc tactacaagt ttgattacaa ggcccatcag cgacagctga ccccgcctga gggctcctca aagtctgagc aagaccaggc agaaaatgag ggcgaggact cggctgtgtt gatggagaga ctgtgcaagt acatctacgc caaggaccgc acagaccgga tccgcacatg tgccatcctc tgccacatct accaccatgc tctgcactcg cgctggtacc aggcccgcga cctcatgctc atgagccact tgcaggacaa cattcagcat gcagacccgc cagtgcagat cctttacaac cgcaccatgg tgcagctggg catctgtgcc ttccgccaag gcctgaccaa ggacgcacac aacgccctgc tggacatcca gtcgagtggc cgagccaagg agcttctggg ccagggcctg ctgctgcgca gcctgcagga gcgcaaccag gagcaggaga aggtggagcg gcgccgtcag gtccccttcc acctgcacat caacctggag ctgctggagt gtgtctacct ggtgtctgcc atgctcctgg agatccccta catggccgcc catgagagcg atgcccgccg acgcatgatc agcaagcagt tccaccacca gctgcgcgtg ggcgagcgac agcccctgct gggtccccct gagtccatgc gggaacatgt ggtcgctgcc tccaaggcca tgaagatggg tgactggaag acctgtcaca gttttatcat caatgagaag atgaatggga aagtgtggga ccttttcccc gaggctgaca aagtccgcac catgctggtt aggaagatcc aggaagagtc actgaggacc tacctcttca cctacagcag tgtctatgac tccatcagca tggagacgct gtcagacatg tttgagctgg atctgcccac tgtgcactcc atcatcagca aaatgatcat taatgaggag ctgatggcct ccctggacca gccaacacag acagtggtga tgcaccgcac tgagcccact gcccagcaga acctggctct gcagctggcc gagaagctgg gcagcctggt ggagaacaac gaacgggtgt ttgaccacaa gcagggcacc tacgggggct acttccgaga ccagaaggac ggctaccgca aaaacgaggg ctacatgcgc cgcggtggct accgccagca gcagtctcag acggcctact ga. It is sometimes possible for the material contained within the vial of "EIF3C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.