Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF2B3 cdna clone

EIF2B3 cDNA Clone

Gene Names
EIF2B3; EIF-2B; EIF2Bgamma
Synonyms
EIF2B3; EIF2B3 cDNA Clone; EIF2B3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaatttcaagcagtagtgatggcagtaggtggaggatctcggatgacagacctaacttccagcattcccaaacctctgcttccagttgggaacaaacctttaatttggtacccattgaacctgcttgagcgtgttggatttgaagaagtcattgtggttacaaccagggatgttcaaaaggctctatgtgcagaattcaagatgaaaatgaagccagatattgtgtgtattcctgatgacgctgacatgggaactgcagattctttgcgctacatatatccaaaacttaagacagatgtgctggtgctgagctgtgatctgataacagacgttgccttacatgaggttgtggacctgtttagagcttatgatgcatcacttgctatgttgatgagaaaaggccaagatagcatagaacctgttcccggtcaaaaggggaaaaaaaaagcagtggagcagcgtgacttcattggagtggacagcacaggaaagaggctgctcttcatggctaatgaagcagacttggatgaagagctggtcattaagggatccatcctacagaagcatcctagaatacgtttccacacgggtcttgtggatgcccacctctactgtttgaaaaaatacatcgtggatttcctaatggaaaatgggtcaataacttctatccggagtgaactgattccatatttagtgagaaaacagttttcctcagcttcctcacaacagggacaagaagaaaaagaggaggatctaaagaaaaaggagctgaagtccttagatatctacagttttataaaagaagccaatacactgaacctggctccctatgatgcctgctggaatgcctgtcgaggagacaggtgggaagacttgtccagatcacaggtgcgctgctatgtccacatcatgaaagaggggctctgctctcgagtgagcacactgggactctacatggaagcaaacagacaggtgcccaaattgctgtctgctctctgtccagaagaaccaccagtccattcgtcagcccagattgtcagcaaacacctggttggagttgacagcctcattgggccagagacacagattggagagaagtcatccattaagcgctcagtcattggctcatcctgtctcataaaagatagagtgactattaccaattgccttctcatgaactcagtcactgtggaggaaggctaa
Sequence Length
1206
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,803 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 2B subunit gamma
NCBI Official Symbol
EIF2B3
NCBI Official Synonym Symbols
EIF-2B; EIF2Bgamma
NCBI Protein Information
translation initiation factor eIF-2B subunit gamma
UniProt Protein Name
Translation initiation factor eIF-2B subunit gamma
UniProt Gene Name
EIF2B3
UniProt Entry Name
EI2BG_HUMAN

NCBI Description

The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]

Uniprot Description

eIF2B-gamma: Catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. Defects in EIF2B3 are a cause of leukodystrophy with vanishing white matter (VWM). VWM is a leukodystrophy that occurs mainly in children. Neurological signs include progressive cerebellar ataxia, spasticity, inconstant optic atrophy and relatively preserved mental abilities. The disease is chronic-progressive with, in most individuals, additional episodes of rapid deterioration following febrile infections or minor head trauma. While childhood onset is the most common form of the disorder, some severe forms are apparent at birth. A severe, early-onset form seen among the Cree and Chippewayan populations of Quebec and Manitoba is called Cree leukoencephalopathy. Milder forms may not become evident until adolescence or adulthood. Some females with milder forms of the disease who survive to adolescence exhibit ovarian dysfunction. This variant of the disorder is called ovarioleukodystrophy. Belongs to the eIF-2B gamma/epsilon subunits family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation; Translation initiation

Chromosomal Location of Human Ortholog: 1p34.1

Cellular Component: cytoplasm; cytosol; eukaryotic translation initiation factor 2B complex

Molecular Function: guanyl-nucleotide exchange factor activity; protein binding; translation factor activity, nucleic acid binding; translation initiation factor activity

Biological Process: cellular response to stimulus; negative regulation of translation initiation in response to stress; oligodendrocyte development; response to glucose stimulus; response to heat; response to peptide hormone stimulus; translational initiation

Disease: Leukoencephalopathy With Vanishing White Matter

Research Articles on EIF2B3

Similar Products

Product Notes

The EIF2B3 eif2b3 (Catalog #AAA1278865) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaatttc aagcagtagt gatggcagta ggtggaggat ctcggatgac agacctaact tccagcattc ccaaacctct gcttccagtt gggaacaaac ctttaatttg gtacccattg aacctgcttg agcgtgttgg atttgaagaa gtcattgtgg ttacaaccag ggatgttcaa aaggctctat gtgcagaatt caagatgaaa atgaagccag atattgtgtg tattcctgat gacgctgaca tgggaactgc agattctttg cgctacatat atccaaaact taagacagat gtgctggtgc tgagctgtga tctgataaca gacgttgcct tacatgaggt tgtggacctg tttagagctt atgatgcatc acttgctatg ttgatgagaa aaggccaaga tagcatagaa cctgttcccg gtcaaaaggg gaaaaaaaaa gcagtggagc agcgtgactt cattggagtg gacagcacag gaaagaggct gctcttcatg gctaatgaag cagacttgga tgaagagctg gtcattaagg gatccatcct acagaagcat cctagaatac gtttccacac gggtcttgtg gatgcccacc tctactgttt gaaaaaatac atcgtggatt tcctaatgga aaatgggtca ataacttcta tccggagtga actgattcca tatttagtga gaaaacagtt ttcctcagct tcctcacaac agggacaaga agaaaaagag gaggatctaa agaaaaagga gctgaagtcc ttagatatct acagttttat aaaagaagcc aatacactga acctggctcc ctatgatgcc tgctggaatg cctgtcgagg agacaggtgg gaagacttgt ccagatcaca ggtgcgctgc tatgtccaca tcatgaaaga ggggctctgc tctcgagtga gcacactggg actctacatg gaagcaaaca gacaggtgcc caaattgctg tctgctctct gtccagaaga accaccagtc cattcgtcag cccagattgt cagcaaacac ctggttggag ttgacagcct cattgggcca gagacacaga ttggagagaa gtcatccatt aagcgctcag tcattggctc atcctgtctc ataaaagata gagtgactat taccaattgc cttctcatga actcagtcac tgtggaggaa ggctaa. It is sometimes possible for the material contained within the vial of "EIF2B3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.