Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF2B2 cdna clone

EIF2B2 cDNA Clone

Gene Names
EIF2B2; EIF2B; EIF-2Bbeta
Synonyms
EIF2B2; EIF2B2 cDNA Clone; EIF2B2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgggatccgcagcgaagggctcggagttgtcagagaggatcgagagcttcgtggagaccctgaagcggggtggtgggccgcgcagctccgaggaaatggctcgggagaccctagggttgctgcgccagatcatcacggaccaccgctggagcaacgcgggggagctgatggagctgatccgcagagagggcaggaggatgacggccgctcagccctccgagaccaccgtgggcaacatggtgcggagagtgctcaagattatccgggaggagtatggcagactccatggacgcaccgacgagagtgatcagcaggagtccctgcacaaactgttgacatccggaggcctaaacgaggatttcagcttccattatgcccaactccagtccaacatcattgaggcgattaatgagctgctagtggagctggaagggacaatggagaacattgcagcccaggctctggagcacattcactccaatgaggtgatcatgaccattggcttctcccgaacagtagaggccttcctcaaagaggctgcccgaaagaggaaattccatgtcattgtagcagagtgtgctcctttctgccagggtcatgaaatggctgtgaatttgtccaaagcaggtattgagacaactgtcatgactgatgctgccatttttgccgttatgtcaagagtcaacaaggtgatcattggcacgaagaccatcctggccaatggggccctgagagctgtgacaggaactcacactctggcactggcagcaaaacaccattccaccccactcatcgtctgtgcacctatgttcaaactttctccacagttccccaatgaagaagactcatttcataagtttgtggctcctgaagaagtcctgccattcacagaaggggacattctggagaaggtcagcgtgcattgccctgtgtttgactacgttcccccagagctcattaccctctttatctccaacattggtgggaatgcaccttcctacatctaccgcctgatgagtgaactctaccatcctgatgatcatgttttatga
Sequence Length
1056
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,990 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 2B subunit beta
NCBI Official Symbol
EIF2B2
NCBI Official Synonym Symbols
EIF2B; EIF-2Bbeta
NCBI Protein Information
translation initiation factor eIF-2B subunit beta
UniProt Protein Name
Translation initiation factor eIF-2B subunit beta
UniProt Gene Name
EIF2B2
UniProt Synonym Gene Names
EIF2BB
UniProt Entry Name
EI2BB_HUMAN

NCBI Description

This gene encodes the beta subunit of eukaryotic initiation factor-2B (EIF2B). EIF2B is involved in protein synthesis and exchanges GDP and GTP for its activation and deactivation. [provided by RefSeq, Aug 2011]

Uniprot Description

eIF2B-beta: eukaryotic translation initiation factor 2B, subunit 5. A translational regulatory protein that functions in the early steps of protein synthesis by catalyzing the exchange of eukaryotic initiation factor 2-bound GDP for GTP. Mutation in EIF2B5 causes childhood ataxia with central nervous system hypomyelination/ vanishing white matter leukodystrophy.

Protein type: GEFs, misc.; RNA-binding; Cell development/differentiation; Translation; GEFs

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: cytoplasm; cytosol; eukaryotic translation initiation factor 2B complex

Molecular Function: ATP binding; GTP binding; guanyl-nucleotide exchange factor activity; protein binding; S-methyl-5-thioribose-1-phosphate isomerase activity; translation initiation factor activity

Biological Process: cellular response to stimulus; central nervous system development; methionine salvage; myelination; oligodendrocyte development; ovarian follicle development; regulation of translational initiation; response to glucose stimulus; response to heat; response to peptide hormone stimulus; translational initiation

Disease: Leukoencephalopathy With Vanishing White Matter

Research Articles on EIF2B2

Similar Products

Product Notes

The EIF2B2 eif2b2 (Catalog #AAA1273161) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgggat ccgcagcgaa gggctcggag ttgtcagaga ggatcgagag cttcgtggag accctgaagc ggggtggtgg gccgcgcagc tccgaggaaa tggctcggga gaccctaggg ttgctgcgcc agatcatcac ggaccaccgc tggagcaacg cgggggagct gatggagctg atccgcagag agggcaggag gatgacggcc gctcagccct ccgagaccac cgtgggcaac atggtgcgga gagtgctcaa gattatccgg gaggagtatg gcagactcca tggacgcacc gacgagagtg atcagcagga gtccctgcac aaactgttga catccggagg cctaaacgag gatttcagct tccattatgc ccaactccag tccaacatca ttgaggcgat taatgagctg ctagtggagc tggaagggac aatggagaac attgcagccc aggctctgga gcacattcac tccaatgagg tgatcatgac cattggcttc tcccgaacag tagaggcctt cctcaaagag gctgcccgaa agaggaaatt ccatgtcatt gtagcagagt gtgctccttt ctgccagggt catgaaatgg ctgtgaattt gtccaaagca ggtattgaga caactgtcat gactgatgct gccatttttg ccgttatgtc aagagtcaac aaggtgatca ttggcacgaa gaccatcctg gccaatgggg ccctgagagc tgtgacagga actcacactc tggcactggc agcaaaacac cattccaccc cactcatcgt ctgtgcacct atgttcaaac tttctccaca gttccccaat gaagaagact catttcataa gtttgtggct cctgaagaag tcctgccatt cacagaaggg gacattctgg agaaggtcag cgtgcattgc cctgtgtttg actacgttcc cccagagctc attaccctct ttatctccaa cattggtggg aatgcacctt cctacatcta ccgcctgatg agtgaactct accatcctga tgatcatgtt ttatga. It is sometimes possible for the material contained within the vial of "EIF2B2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.