Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF2A cdna clone

EIF2A cDNA Clone

Gene Names
EIF2A; CDA02; EIF-2A; MST089; MSTP004; MSTP089
Synonyms
EIF2A; EIF2A cDNA Clone; EIF2A cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccgtccacgccgctcttgacagtccgaggatcagaaggactgtacatggtgaatggaccaccacattttacagaaagcacagtgtttccaagggaatctgggaagaattgcaaagtctgtatctttagtaaggatgggaccttgtttgcctggggcaatggagaaaaagtaaatattatcagtgtcactaacaagggactactgcactccttcgacctcctgaaggcagtttgccttgaattctcacccaaaaatactgtcctggcaacgtggcagccttacactacttctaaagatggcacagctgggatacccaacctacaactttatgatgtgaaaactgggacatgtttgaaatctttcatccagaaaaaaatgcaaaattggtgtccatcctggtcagaagatgaaactctttgtgcccgcaatgttaacaatgaagttcacttctttgaaaacaacaattttaacacaattgcaaataaattgcatttgcaaaaaattaatgactttgtattatcacctggaccccaaccatacaaggtggctgtctatgttccaggaagtaaaggtgcaccttcatttgttagattatatcagtaccccaactttgctggacctcatgcagctttagctaataaaagtttctttaaggcagataaagttacaatgctgtggaataaaaaagctactgctgtgttggtaatagctagcacagatgttgacaagacaggagcttcctactatggagaacaaactctacactacattgcaacaaatggagaaagtgctgtagtgcaattaccaaaaaatggccccatttatgatgtagtttggaattctagttctactgagttttgtgctgtatatggttttatgcctgccaaagcgacaattttcaacttgaaatgtgatcctgtatttgactttggaactggtcctcgtaatgcagcctactatagccctcatggacatatattagtattagctggatttggaaatctgaggggacaaatggaagtgtgggatgtgaaaaactacaaacttatttctaaaccggtggcttctgattctacatattttgcttggtgcccggatggtgagcatattttaacagctacatgtgctcccaggttacgggttaataatggatacaaaatttggcattatactggctctatcttgcacaagtatgatgtgccatcaaatgcagaattatggcaggtttcttggcagccatttttggatggaatatttccagcaaaaacaataacttaccaagcagttccaagtgaagtacccaatgaggaacctaaagttgcaacagcttatagacccccagctttaagaaataaaccaatcaccaattccaaattgcatgaagaggaaccacctcagaatatgaaaccacaatcaggaaacgataagccattatcaaaaacagctcttaaaaatcaaaggaagcatgaagctaagaaagctgcaaagcaggaagcaagaagtgacaagagtccagatttggcacctactcctgccccacagagcacaccacgaaacactgtctctcagtcaatttctggggaccctgagatagacaaaaaaatcaagaacctaaagaagaaactgaaagcaatcgaacaactgaaagaacaagcagcaactggaaaacagctagaaaaaaatcagttggagaaaattcagaaagaaacagcccttctccaggagctggaagatttgaaattgggtatttaa
Sequence Length
1758
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,994 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 2A, 65kDa, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 2A
NCBI Official Symbol
EIF2A
NCBI Official Synonym Symbols
CDA02; EIF-2A; MST089; MSTP004; MSTP089
NCBI Protein Information
eukaryotic translation initiation factor 2A
UniProt Protein Name
Eukaryotic translation initiation factor 2A
UniProt Gene Name
EIF2A
UniProt Synonym Gene Names
eIF-2A
UniProt Entry Name
EIF2A_HUMAN

NCBI Description

This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]

Uniprot Description

EIF2A: Functions in the early steps of protein synthesis of a small number of specific mRNAs. Acts by directing the binding of methionyl-tRNAi to 40S ribosomal subunits. In contrast to the eIF- 2 complex, it binds methionyl-tRNAi to 40 S subunits in a codon- dependent manner, whereas the eIF-2 complex binds methionyl-tRNAi to 40 S subunits in a GTP-dependent manner. May act by impiging the expression of specific proteins. Belongs to the WD repeat EIF2A family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation

Chromosomal Location of Human Ortholog: 3q25.1

Cellular Component: cell-cell adherens junction; cytoplasm; eukaryotic translation initiation factor 2 complex; extracellular space

Molecular Function: protein binding; ribosome binding; translation initiation factor activity; tRNA binding

Biological Process: regulation of translation; ribosome assembly

Research Articles on EIF2A

Similar Products

Product Notes

The EIF2A eif2a (Catalog #AAA1272276) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccgt ccacgccgct cttgacagtc cgaggatcag aaggactgta catggtgaat ggaccaccac attttacaga aagcacagtg tttccaaggg aatctgggaa gaattgcaaa gtctgtatct ttagtaagga tgggaccttg tttgcctggg gcaatggaga aaaagtaaat attatcagtg tcactaacaa gggactactg cactccttcg acctcctgaa ggcagtttgc cttgaattct cacccaaaaa tactgtcctg gcaacgtggc agccttacac tacttctaaa gatggcacag ctgggatacc caacctacaa ctttatgatg tgaaaactgg gacatgtttg aaatctttca tccagaaaaa aatgcaaaat tggtgtccat cctggtcaga agatgaaact ctttgtgccc gcaatgttaa caatgaagtt cacttctttg aaaacaacaa ttttaacaca attgcaaata aattgcattt gcaaaaaatt aatgactttg tattatcacc tggaccccaa ccatacaagg tggctgtcta tgttccagga agtaaaggtg caccttcatt tgttagatta tatcagtacc ccaactttgc tggacctcat gcagctttag ctaataaaag tttctttaag gcagataaag ttacaatgct gtggaataaa aaagctactg ctgtgttggt aatagctagc acagatgttg acaagacagg agcttcctac tatggagaac aaactctaca ctacattgca acaaatggag aaagtgctgt agtgcaatta ccaaaaaatg gccccattta tgatgtagtt tggaattcta gttctactga gttttgtgct gtatatggtt ttatgcctgc caaagcgaca attttcaact tgaaatgtga tcctgtattt gactttggaa ctggtcctcg taatgcagcc tactatagcc ctcatggaca tatattagta ttagctggat ttggaaatct gaggggacaa atggaagtgt gggatgtgaa aaactacaaa cttatttcta aaccggtggc ttctgattct acatattttg cttggtgccc ggatggtgag catattttaa cagctacatg tgctcccagg ttacgggtta ataatggata caaaatttgg cattatactg gctctatctt gcacaagtat gatgtgccat caaatgcaga attatggcag gtttcttggc agccattttt ggatggaata tttccagcaa aaacaataac ttaccaagca gttccaagtg aagtacccaa tgaggaacct aaagttgcaa cagcttatag acccccagct ttaagaaata aaccaatcac caattccaaa ttgcatgaag aggaaccacc tcagaatatg aaaccacaat caggaaacga taagccatta tcaaaaacag ctcttaaaaa tcaaaggaag catgaagcta agaaagctgc aaagcaggaa gcaagaagtg acaagagtcc agatttggca cctactcctg ccccacagag cacaccacga aacactgtct ctcagtcaat ttctggggac cctgagatag acaaaaaaat caagaaccta aagaagaaac tgaaagcaat cgaacaactg aaagaacaag cagcaactgg aaaacagcta gaaaaaaatc agttggagaa aattcagaaa gaaacagccc ttctccagga gctggaagat ttgaaattgg gtatttaa. It is sometimes possible for the material contained within the vial of "EIF2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.