Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF1AX cdna clone

EIF1AX cDNA Clone

Gene Names
EIF1AX; EIF1A; EIF4C; eIF-1A; eIF-4C; EIF1AP1
Synonyms
EIF1AX; EIF1AX cDNA Clone; EIF1AX cdna clone
Ordering
For Research Use Only!
Sequence
atgcccaagaataaaggtaaaggaggtaaaaacagacgcaggggtaagaatgagaatgaatctgaaaaaagagaactggtattcaaagaggatggtcaggagtatgctcaggtaatcaaaatgttgggaaatggacggctagaagcaatgtgtttcgatggtgtaaagaggttatgtcacatcagaggaaaattgagaaaaaaggtttggataaatacctcggacattattttggttggtctccgagactaccaggataacaaagctgatgtaattttaaaatacaatgcagacgaagctagaagtctgaaggcatacggcgagcttccagagcatgctaaaatcaatgaaactgatacatttggtcctggagatgatgatgaaattcagtttgatgacattggagatgatgatgaagatattgatgacatctaa
Sequence Length
435
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,460 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 1A, X-linked, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 1A, X-linked
NCBI Official Symbol
EIF1AX
NCBI Official Synonym Symbols
EIF1A; EIF4C; eIF-1A; eIF-4C; EIF1AP1
NCBI Protein Information
eukaryotic translation initiation factor 1A, X-chromosomal
UniProt Protein Name
Eukaryotic translation initiation factor 1A, X-chromosomal
UniProt Gene Name
EIF1AX
UniProt Synonym Gene Names
EIF1A; EIF4C; eIF-1A X isoform; eIF-4C
UniProt Entry Name
IF1AX_HUMAN

NCBI Description

This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA. [provided by RefSeq, Jul 2008]

Uniprot Description

EIF1AX: Seems to be required for maximal rate of protein biosynthesis. Enhances ribosome dissociation into subunits and stabilizes the binding of the initiator Met-tRNA(I) to 40 S ribosomal subunits. Belongs to the eIF-1A family

Protein type: RNA-binding; Translation; Translation initiation

Chromosomal Location of Human Ortholog: Xp22.12

Cellular Component: cytosol

Molecular Function: protein binding; translation factor activity, nucleic acid binding

Biological Process: translational initiation

Research Articles on EIF1AX

Similar Products

Product Notes

The EIF1AX eif1ax (Catalog #AAA1278167) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccaaga ataaaggtaa aggaggtaaa aacagacgca ggggtaagaa tgagaatgaa tctgaaaaaa gagaactggt attcaaagag gatggtcagg agtatgctca ggtaatcaaa atgttgggaa atggacggct agaagcaatg tgtttcgatg gtgtaaagag gttatgtcac atcagaggaa aattgagaaa aaaggtttgg ataaatacct cggacattat tttggttggt ctccgagact accaggataa caaagctgat gtaattttaa aatacaatgc agacgaagct agaagtctga aggcatacgg cgagcttcca gagcatgcta aaatcaatga aactgataca tttggtcctg gagatgatga tgaaattcag tttgatgaca ttggagatga tgatgaagat attgatgaca tctaa. It is sometimes possible for the material contained within the vial of "EIF1AX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.