EID3 cdna clone
EID3 cDNA Clone
Gene Names
EID3; NS4EB; NSE4B; NSMCE4B
Synonyms
EID3; EID3 cDNA Clone; EID3 cdna clone
Sequence
atgaagatggatgtgtcagtgagggccgcgggctgctccgacgacctcagctctggggaggccgacgtagacccaaagctcctggagctcaccgctgacgaggagaagtgccgcagcatccgcaggcagtaccggcagctcatgtactgcgtgcggcagaaccgggaggacatcgtgagctcggcgaacaactccttaaccgaggctctggaggaagccaacgtcctctttgatggcgtgagccgaaccagagaagcagccctcgacgcccggtttcttgttatggcttctgatttgggtaaagaaaaggcaaagcagttaaactcagatatgaacttctttaatcagttagcattttgtgactttctgtttctgttcgtgggtctgaattggatggaaggcgatcctgacaagttgagtgattgtgatgatagcatagctctttccttctggaaggcaatagaaaaggaagcaacatcctggatggtaaaagctgagacattccattttgtttttggttcattcaagctagaacgttctgcaccaaagccccgacttgaacaccagaaaaaagttcgcaagatggaagaaaatggcaacatgcctacaaagttgcagaagttggacctgagtagttatccagaagcgacagaaaaaaacgtagaaaggattttgggattgttgcaaacctactttcgaaagtatcctgatactcctgtgtcctattttgagtttgtgattgatccaaactctttttctcgtactgtggagaatatattttatgtttcttttattgtaagagatggttttgcaagaataaggcttgatgaagacaggctgccaatattagagccgatgaatgttaaccaaatgggtgagggaaatgattccagttgccatggcaggaaacagggagttatatctttgactttacaggagtggaaaaacattgtggcagcttttgaaatttctgaggctatgattacatactcctcatactaa
Sequence Length
1002
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,168 Da
NCBI Official Full Name
Homo sapiens EP300 interacting inhibitor of differentiation 3, mRNA
NCBI Official Synonym Full Names
EP300 interacting inhibitor of differentiation 3
NCBI Official Symbol
EID3
NCBI Official Synonym Symbols
NS4EB; NSE4B; NSMCE4B
NCBI Protein Information
EP300-interacting inhibitor of differentiation 3
UniProt Protein Name
EP300-interacting inhibitor of differentiation 3
Protein Family
UniProt Gene Name
EID3
UniProt Synonym Gene Names
EID-3; NS4EB; Non-SMC element 4 homolog B
UniProt Entry Name
EID3_HUMAN
Uniprot Description
EID3: Tissue-specific component of the SMC5-SMC6 complex, a complex involved in repair of DNA double-strand breaks by homologous recombination. The complex may promote sister chromatid homologous recombination by recruiting the SMC1-SMC3 cohesin complex to double-strand breaks. The complex is required for telomere maintenance via recombination and mediates sumoylation of shelterin complex (telosome) components. Belongs to the NSE4 family.
Chromosomal Location of Human Ortholog: 12q23.3
Cellular Component: nucleoplasm
Molecular Function: identical protein binding; protein binding
Biological Process: protein sumoylation
Research Articles on EID3
Similar Products
Product Notes
The EID3 eid3 (Catalog #AAA1273648) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatgg atgtgtcagt gagggccgcg ggctgctccg acgacctcag ctctggggag gccgacgtag acccaaagct cctggagctc accgctgacg aggagaagtg ccgcagcatc cgcaggcagt accggcagct catgtactgc gtgcggcaga accgggagga catcgtgagc tcggcgaaca actccttaac cgaggctctg gaggaagcca acgtcctctt tgatggcgtg agccgaacca gagaagcagc cctcgacgcc cggtttcttg ttatggcttc tgatttgggt aaagaaaagg caaagcagtt aaactcagat atgaacttct ttaatcagtt agcattttgt gactttctgt ttctgttcgt gggtctgaat tggatggaag gcgatcctga caagttgagt gattgtgatg atagcatagc tctttccttc tggaaggcaa tagaaaagga agcaacatcc tggatggtaa aagctgagac attccatttt gtttttggtt cattcaagct agaacgttct gcaccaaagc cccgacttga acaccagaaa aaagttcgca agatggaaga aaatggcaac atgcctacaa agttgcagaa gttggacctg agtagttatc cagaagcgac agaaaaaaac gtagaaagga ttttgggatt gttgcaaacc tactttcgaa agtatcctga tactcctgtg tcctattttg agtttgtgat tgatccaaac tctttttctc gtactgtgga gaatatattt tatgtttctt ttattgtaag agatggtttt gcaagaataa ggcttgatga agacaggctg ccaatattag agccgatgaa tgttaaccaa atgggtgagg gaaatgattc cagttgccat ggcaggaaac agggagttat atctttgact ttacaggagt ggaaaaacat tgtggcagct tttgaaattt ctgaggctat gattacatac tcctcatact aa. It is sometimes possible for the material contained within the vial of "EID3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
