Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EFEMP2 cdna clone

EFEMP2 cDNA Clone

Gene Names
EFEMP2; MBP1; UPH1; FBLN4; ARCL1B
Synonyms
EFEMP2; EFEMP2 cDNA Clone; EFEMP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctcccctgcgcctcctgcctacccgggtctctactgctctgggcgctgctactgttgctcttgggatcagcttctcctcaggattctgaagagcccgacagctacacggaatgcacagatggctatgagtgggacccagacagccagcactgccgggatgtcaacgagtgtctgaccatccctgaggcctgcaagggggaaatgaagtgcatcaaccactacgggggctacttgtgcctgccccgctccgctgccgtcatcaacgacctacacggcgagggacccccgccaccagtgcctcccgctcaacaccccaacccctgcccaccaggctatgagcccgacgatcaggacagctgtgtggatgtggacgagtgtgcccaggccctgcacgactgtcgccccagccaggactgccataacttgcctggctcctatcagtgcacctgccctgatggttaccgcaagatcgggcccgagtgtgtggacatagacgagtgccgctaccgctactgccagcaccgctgcgtgaacctgcctggctccttccgctgccagtgcgagccgggcttccagctggggcctaacaaccgctcctgtgttgatgtgaacgagtgtgacatgggggccccatgcgagcagcgctgcttcaactcctatgggaccttcctgtgtcgctgccaccagggctatgagctgcatcgggatggcttctcctgcagtgatattgatgagtgtagctactccagctacctctgtcagtaccgctgcgtcaacgagccaggccgtttctcctgccactgcccacagggttaccagctgctggccacacgcctctgccaagacattgatgagtgtgagtctggtgcgcaccagtgctccgaggcccaaacctgtgtcaacttccatgggggctaccgctgcgtggacaccaaccgctgcgtggagccctacatccaggtctctgagaaccgctgtctctgcccggcctccaaccctctatgtcgagagcagccttcatccattgtgcaccgctacatgaccatcacctcggagcggagcgtgcccgctgacgtgttccagatccaggcgacctccgtctaccccggtgcctacaatgcctttcagatccgtgctggaaactcgcagggggacttttacattaggcaaatcaacaacgtcagcgccatgctggtcctcgcccggccggtgacgggcccccgggagtacgtgctggacctggagatggtcaccatgaattccctcatgagctaccgggccagctctgtactgaggctcaccgtctttgtaggggcctacaccttctga
Sequence Length
1332
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,405 Da
NCBI Official Full Name
Homo sapiens EGF-containing fibulin-like extracellular matrix protein 2, mRNA
NCBI Official Synonym Full Names
EGF containing fibulin like extracellular matrix protein 2
NCBI Official Symbol
EFEMP2
NCBI Official Synonym Symbols
MBP1; UPH1; FBLN4; ARCL1B
NCBI Protein Information
EGF-containing fibulin-like extracellular matrix protein 2
UniProt Protein Name
EGF-containing fibulin-like extracellular matrix protein 2
UniProt Gene Name
EFEMP2
UniProt Synonym Gene Names
FBLN4; FIBL-4
UniProt Entry Name
FBLN4_HUMAN

NCBI Description

A large number of extracellular matrix proteins have been found to contain variations of the epidermal growth factor (EGF) domain and have been implicated in functions as diverse as blood coagulation, activation of complement and determination of cell fate during development. The protein encoded by this gene contains four EGF2 domains and six calcium-binding EGF2 domains. This gene is necessary for elastic fiber formation and connective tissue development. Defects in this gene are cause of an autosomal recessive cutis laxa syndrome. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

EFEMP2: Defects in EFEMP2 are the cause of cutis laxa, autosomal recessive, type 1B (ARCL1B). A connective tissue disorder characterized by characterized by loose, hyperextensible skin with decreased resilience and elasticity leading to a premature aged appearance. Face, hands, feet, joints, and torso may be differentially affected. The clinical spectrum of autosomal recessive cutis laxa is highly heterogeneous with respect to organ involvement and severity. ARCL1B features include emphysema, lethal pulmonary artery occlusion, aortic aneurysm, cardiopulmonary insufficiency, birth fractures, arachnodactyly, and fragility of blood vessels. Belongs to the fibulin family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 11q13.1

Cellular Component: basement membrane; extracellular region

Molecular Function: extracellular matrix structural constituent; protein binding

Disease: Cutis Laxa, Autosomal Recessive, Type Ib

Research Articles on EFEMP2

Similar Products

Product Notes

The EFEMP2 efemp2 (Catalog #AAA1269545) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcccct gcgcctcctg cctacccggg tctctactgc tctgggcgct gctactgttg ctcttgggat cagcttctcc tcaggattct gaagagcccg acagctacac ggaatgcaca gatggctatg agtgggaccc agacagccag cactgccggg atgtcaacga gtgtctgacc atccctgagg cctgcaaggg ggaaatgaag tgcatcaacc actacggggg ctacttgtgc ctgccccgct ccgctgccgt catcaacgac ctacacggcg agggaccccc gccaccagtg cctcccgctc aacaccccaa cccctgccca ccaggctatg agcccgacga tcaggacagc tgtgtggatg tggacgagtg tgcccaggcc ctgcacgact gtcgccccag ccaggactgc cataacttgc ctggctccta tcagtgcacc tgccctgatg gttaccgcaa gatcgggccc gagtgtgtgg acatagacga gtgccgctac cgctactgcc agcaccgctg cgtgaacctg cctggctcct tccgctgcca gtgcgagccg ggcttccagc tggggcctaa caaccgctcc tgtgttgatg tgaacgagtg tgacatgggg gccccatgcg agcagcgctg cttcaactcc tatgggacct tcctgtgtcg ctgccaccag ggctatgagc tgcatcggga tggcttctcc tgcagtgata ttgatgagtg tagctactcc agctacctct gtcagtaccg ctgcgtcaac gagccaggcc gtttctcctg ccactgccca cagggttacc agctgctggc cacacgcctc tgccaagaca ttgatgagtg tgagtctggt gcgcaccagt gctccgaggc ccaaacctgt gtcaacttcc atgggggcta ccgctgcgtg gacaccaacc gctgcgtgga gccctacatc caggtctctg agaaccgctg tctctgcccg gcctccaacc ctctatgtcg agagcagcct tcatccattg tgcaccgcta catgaccatc acctcggagc ggagcgtgcc cgctgacgtg ttccagatcc aggcgacctc cgtctacccc ggtgcctaca atgcctttca gatccgtgct ggaaactcgc agggggactt ttacattagg caaatcaaca acgtcagcgc catgctggtc ctcgcccggc cggtgacggg cccccgggag tacgtgctgg acctggagat ggtcaccatg aattccctca tgagctaccg ggccagctct gtactgaggc tcaccgtctt tgtaggggcc tacaccttct ga. It is sometimes possible for the material contained within the vial of "EFEMP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.