Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EEF1D cdna clone

EEF1D cDNA Clone

Gene Names
EEF1D; EF1D; EF-1D; FP1047
Synonyms
EEF1D; EEF1D cDNA Clone; EEF1D cdna clone
Ordering
For Research Use Only!
Sequence
atgaggagcgggaaggcctcctgcaccctggagaccgtgtgggaagacaagcacaagtatgaggaggccgagcggcgcttctacgaacacgaggccacacaggcggccgcctccgcccagcagctgccagccgaggggccagccatgaatgggcccggccaggacgaccctgaggacgctgatgaggcggaagcccctgacggcggcagcaggcgtgatcccaggaagagccaggacagcaggaagcccctgcagaaaaagaggaagcgctcccccaagagcgggctcggccccgcggacctggccctcctgggcctctcggccgaacgtgtgtggctggacaagtcacttttcgaccaggcagagagctcctaccgccagaagctggcagatgtggctgcccaggcagcctggcctcctgccttggccccttggggtctctgcacccatggaaaccaggtggcctgccaccacgtgacctgggggatctgggtcaacaagtcctccttcgaccaggctgagcgggccttcgtggagtggtctcaggccctgttgctggcccccgagggcagccgcaggcaggggactcccaacacaggccagcaggtggccgtccccgacctggcccaccagcccagcccaccggtcaatggccagcccccgctgggcagcctgcaggcactggttcgggaggtgtggctggagaagccccggtatgatgcagccgagaggggcttctacgaggccctgtttgacggccatcccccagggaaggtgcgcctgcaagagcgagccggcctggccgagggtgcccggcggggccgcagagaccggcggggccgcaacatcttagggaacaagcgggccgggctgcgacgggccgatggggaggccccctctgccttgccctactgttacttcctgcagaaggatgcagaggccccctggctcagcaagcctgcctacgacagcgccgagtgccgccaccacgctgccgaggccctgcgtgtggcctggtgcctcgaagctgcctccctgtctcaccgacccggtcctcggtctggcctgtccgtgtccagcctgagacccaacagaaaaatggctacaaacttcctagcacatgagaagatctggttcgacaagttcaaatatgacgacgcagaaaggagattctacgagcagatgaacgggcctgtggcaggtgcctcccgccaggagaacggcgccagcgtgatcctccgtgacattgcgagagccagagagaacatccagaaatccctggctggaagctcaggccccggggcctccagcggcaccagcggagaccacggtgagctcgtcgtccggattgccagtctggaagtggagaaccagagtctgcgtggcgtggtacaggagctgcagcaggccatctccaagctggaggcccggctgaacgtgctggagaagagctcgcctggccaccgggccacggccccacagacccagcacgtatctcccatgcgccaagtggagcccccagccaagaagccagccacaccagcagaggatgacgaggatgatgacattgacctgtttggcagtgacaatgaggaggaggacaaggaggcggcacagctgcgggaggagcggctacggcagtacgcggagaagaaggccaagaagcctgcactggtggccaagtcctccatcctgctggatgtcaagccttgggatgatgagacggacatggcccagctggaggcctgtgtgcgctctatccagctggacgggctggtctggggggcttccaagctggtgcccgtgggctacggtatccggaagctacagattcagtgtgtggtggaggacgacaaggtggggacagacttgctggaggaggagatcaccaagtttgaggagcacgtgcagagtgtcgatatcgcagctttcaacaagatctga
Sequence Length
1944
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,071 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein), mRNA
NCBI Official Synonym Full Names
eukaryotic translation elongation factor 1 delta
NCBI Official Symbol
EEF1D
NCBI Official Synonym Symbols
EF1D; EF-1D; FP1047
NCBI Protein Information
elongation factor 1-delta
UniProt Protein Name
Elongation factor 1-delta
Protein Family
UniProt Gene Name
EEF1D
UniProt Synonym Gene Names
EF1D; EF-1-delta
UniProt Entry Name
EF1D_HUMAN

NCBI Description

This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.[provided by RefSeq, Aug 2010]

Uniprot Description

EEF1D: EF-1-beta and EF-1-delta stimulate the exchange of GDP bound to EF-1-alpha to GTP. Belongs to the EF-1-beta/EF-1-delta family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation elongation; Translation

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; endoplasmic reticulum; nucleolus; nucleus

Molecular Function: protein binding; signal transducer activity; translation factor activity, nucleic acid binding

Biological Process: positive regulation of I-kappaB kinase/NF-kappaB cascade; translational elongation

Research Articles on EEF1D

Similar Products

Product Notes

The EEF1D eef1d (Catalog #AAA1271160) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggagcg ggaaggcctc ctgcaccctg gagaccgtgt gggaagacaa gcacaagtat gaggaggccg agcggcgctt ctacgaacac gaggccacac aggcggccgc ctccgcccag cagctgccag ccgaggggcc agccatgaat gggcccggcc aggacgaccc tgaggacgct gatgaggcgg aagcccctga cggcggcagc aggcgtgatc ccaggaagag ccaggacagc aggaagcccc tgcagaaaaa gaggaagcgc tcccccaaga gcgggctcgg ccccgcggac ctggccctcc tgggcctctc ggccgaacgt gtgtggctgg acaagtcact tttcgaccag gcagagagct cctaccgcca gaagctggca gatgtggctg cccaggcagc ctggcctcct gccttggccc cttggggtct ctgcacccat ggaaaccagg tggcctgcca ccacgtgacc tgggggatct gggtcaacaa gtcctccttc gaccaggctg agcgggcctt cgtggagtgg tctcaggccc tgttgctggc ccccgagggc agccgcaggc aggggactcc caacacaggc cagcaggtgg ccgtccccga cctggcccac cagcccagcc caccggtcaa tggccagccc ccgctgggca gcctgcaggc actggttcgg gaggtgtggc tggagaagcc ccggtatgat gcagccgaga ggggcttcta cgaggccctg tttgacggcc atcccccagg gaaggtgcgc ctgcaagagc gagccggcct ggccgagggt gcccggcggg gccgcagaga ccggcggggc cgcaacatct tagggaacaa gcgggccggg ctgcgacggg ccgatgggga ggccccctct gccttgccct actgttactt cctgcagaag gatgcagagg ccccctggct cagcaagcct gcctacgaca gcgccgagtg ccgccaccac gctgccgagg ccctgcgtgt ggcctggtgc ctcgaagctg cctccctgtc tcaccgaccc ggtcctcggt ctggcctgtc cgtgtccagc ctgagaccca acagaaaaat ggctacaaac ttcctagcac atgagaagat ctggttcgac aagttcaaat atgacgacgc agaaaggaga ttctacgagc agatgaacgg gcctgtggca ggtgcctccc gccaggagaa cggcgccagc gtgatcctcc gtgacattgc gagagccaga gagaacatcc agaaatccct ggctggaagc tcaggccccg gggcctccag cggcaccagc ggagaccacg gtgagctcgt cgtccggatt gccagtctgg aagtggagaa ccagagtctg cgtggcgtgg tacaggagct gcagcaggcc atctccaagc tggaggcccg gctgaacgtg ctggagaaga gctcgcctgg ccaccgggcc acggccccac agacccagca cgtatctccc atgcgccaag tggagccccc agccaagaag ccagccacac cagcagagga tgacgaggat gatgacattg acctgtttgg cagtgacaat gaggaggagg acaaggaggc ggcacagctg cgggaggagc ggctacggca gtacgcggag aagaaggcca agaagcctgc actggtggcc aagtcctcca tcctgctgga tgtcaagcct tgggatgatg agacggacat ggcccagctg gaggcctgtg tgcgctctat ccagctggac gggctggtct ggggggcttc caagctggtg cccgtgggct acggtatccg gaagctacag attcagtgtg tggtggagga cgacaaggtg gggacagact tgctggagga ggagatcacc aagtttgagg agcacgtgca gagtgtcgat atcgcagctt tcaacaagat ctga. It is sometimes possible for the material contained within the vial of "EEF1D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.