Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EDNRB cdna clone

EDNRB cDNA Clone

Gene Names
EDNRB; ETB; ET-B; ETB1; ETBR; ETRB; HSCR; WS4A; ABCDS; ET-BR; HSCR2
Synonyms
EDNRB; EDNRB cDNA Clone; EDNRB cdna clone
Ordering
For Research Use Only!
Sequence
atgcagccgcctccaagtctgtgcggacgcgccctggttgcgctggttcttgcctgcggcctgtcgcggatctggggagaggagagaggcttcccgcctgacagggccactccgcttttgcaaaccgcagagataatgacgccacccactaagaccttatggcccaagggttccaacgccagtctggcgcggtcgttggcacctgcggaggtgcctaaaggagacaggacggcaggatctccgccacgcaccatctcccctcccccgtgccaaggacccatcgagatcaaggagactttcaaatacatcaacacggttgtgtcctgccttgtgttcgtgctggggatcatcgggaactccacacttctgagaattatctacaagaacaagtgcatgcgaaacggtcccaatatcttgatcgccagcttggctctgggagacctgctgcacatcgtcattgacatccctatcaatgtctacaagctgctggcagaggactggccatttggagctgagatgtgtaagctggtgcctttcatacagaaagcctccgtgggaatcactgtgctgagtctatgtgctctgagtattgacagatatcgagctgttgcttcttggagtagaattaaaggaattggggttccaaaatggacagcagtagaaattgttttgatttgggtggtctctgtggttctggctgtccctgaagccataggttttgatataattacgatggactacaaaggaagttatctgcgaatctgcttgcttcatcccgttcagaagacagctttcatgcagttttacaagacagcaaaagattggtggctgttcagtttctatttctgcttgccattggccatcactgcatttttttatacactaatgacctgtgaaatgttgagaaagaaaagtggcatgcagattgctttaaatgatcacctaaagcagagacgggaagtggccaaaaccgtcttttgcctggtccttgtctttgccctctgctggcttccccttcacctcagcaggattctgaagctcactctttataatcagaatgatcccaatagatgtgaacttttgagctttctgttggtattggactatattggtatcaacatggcttcactgaattcctgcattaacccaattgctctgtatttggtgagcaaaagattcaaaaactgctttaagtcatgcttatgctgctggtgccagtcatttgaagaaaaacagtccttggaggaaaagcagtcgtgcttaaagttcaaagctaatgatcacggatatgacaacttccgttccagtaataaatacagctcatcttga
Sequence Length
1329
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,480 Da
NCBI Official Full Name
Homo sapiens endothelin receptor type B, mRNA
NCBI Official Synonym Full Names
endothelin receptor type B
NCBI Official Symbol
EDNRB
NCBI Official Synonym Symbols
ETB; ET-B; ETB1; ETBR; ETRB; HSCR; WS4A; ABCDS; ET-BR; HSCR2
NCBI Protein Information
endothelin B receptor
UniProt Protein Name
Endothelin B receptor
Protein Family
UniProt Gene Name
EDNRB
UniProt Synonym Gene Names
ETRB; ET-B; ET-BR
UniProt Entry Name
EDNRB_HUMAN

NCBI Description

The protein encoded by this gene is a G protein-coupled receptor which activates a phosphatidylinositol-calcium second messenger system. Its ligand, endothelin, consists of a family of three potent vasoactive peptides: ET1, ET2, and ET3. Studies suggest that the multigenic disorder, Hirschsprung disease type 2, is due to mutations in the endothelin receptor type B gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

ETB: a G protein-coupled receptor which activates a phosphatidylinoitol-calcium second messenger system. Its ligand, endothelin, consists of a family of three potent vasoactive peptides: ET1, ET2, and ET3. Studies suggest that the multigenic disorder, Hirschsprung disease type 2, is due to mutation in endothelin receptor type B gene. Essential component in the normal development of two neuronal crest-derived cell lineages. Two splice variant isoforms have been described.

Protein type: Membrane protein, multi-pass; GPCR, family 1; Receptor, GPCR; Membrane protein, integral

Chromosomal Location of Human Ortholog: 13q22

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: endothelin receptor activity; peptide hormone binding; protein binding

Biological Process: cell surface receptor linked signal transduction; enteric nervous system development; macrophage chemotaxis; negative regulation of adenylate cyclase activity; negative regulation of cellular protein metabolic process; negative regulation of neuron maturation; negative regulation of transcription from RNA polymerase II promoter; nervous system development; vasoconstriction; vein smooth muscle contraction

Disease: Abcd Syndrome; Hirschsprung Disease, Susceptibility To, 2; Waardenburg Syndrome, Type 4a

Research Articles on EDNRB

Similar Products

Product Notes

The EDNRB ednrb (Catalog #AAA1275924) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagccgc ctccaagtct gtgcggacgc gccctggttg cgctggttct tgcctgcggc ctgtcgcgga tctggggaga ggagagaggc ttcccgcctg acagggccac tccgcttttg caaaccgcag agataatgac gccacccact aagaccttat ggcccaaggg ttccaacgcc agtctggcgc ggtcgttggc acctgcggag gtgcctaaag gagacaggac ggcaggatct ccgccacgca ccatctcccc tcccccgtgc caaggaccca tcgagatcaa ggagactttc aaatacatca acacggttgt gtcctgcctt gtgttcgtgc tggggatcat cgggaactcc acacttctga gaattatcta caagaacaag tgcatgcgaa acggtcccaa tatcttgatc gccagcttgg ctctgggaga cctgctgcac atcgtcattg acatccctat caatgtctac aagctgctgg cagaggactg gccatttgga gctgagatgt gtaagctggt gcctttcata cagaaagcct ccgtgggaat cactgtgctg agtctatgtg ctctgagtat tgacagatat cgagctgttg cttcttggag tagaattaaa ggaattgggg ttccaaaatg gacagcagta gaaattgttt tgatttgggt ggtctctgtg gttctggctg tccctgaagc cataggtttt gatataatta cgatggacta caaaggaagt tatctgcgaa tctgcttgct tcatcccgtt cagaagacag ctttcatgca gttttacaag acagcaaaag attggtggct gttcagtttc tatttctgct tgccattggc catcactgca tttttttata cactaatgac ctgtgaaatg ttgagaaaga aaagtggcat gcagattgct ttaaatgatc acctaaagca gagacgggaa gtggccaaaa ccgtcttttg cctggtcctt gtctttgccc tctgctggct tccccttcac ctcagcagga ttctgaagct cactctttat aatcagaatg atcccaatag atgtgaactt ttgagctttc tgttggtatt ggactatatt ggtatcaaca tggcttcact gaattcctgc attaacccaa ttgctctgta tttggtgagc aaaagattca aaaactgctt taagtcatgc ttatgctgct ggtgccagtc atttgaagaa aaacagtcct tggaggaaaa gcagtcgtgc ttaaagttca aagctaatga tcacggatat gacaacttcc gttccagtaa taaatacagc tcatcttga. It is sometimes possible for the material contained within the vial of "EDNRB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.