Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EDF1 cdna clone

EDF1 cDNA Clone

Gene Names
EDF1; MBF1; EDF-1; CFAP280
Synonyms
EDF1; EDF1 cDNA Clone; EDF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgagagcgactgggacacggtgacggtgctgcgcaagaagggccctacggccgcccaggccaaatccaagcaggctatcttagcggcacagagacgaggagaagatgtggagacttccaagaaatgggctgctggccagaacaaacaacattctattaccaagaacacggccaagctggaccgggagacagaggagctgcaccatgacagggtgaccctggaggtgggcaaggtgatccagcaaggtcggcagagcaaggggcttacgcagaaggacctggccacgaaaatcaatgagaagccacaggtgatcgcggactatgagagcggacgggccatacccaataaccaggtgcttggcaaaatcgagcgggccattggcctcaagctccggggaaaggacattggaaagcccatcgagaaggggcctagggcgaaatga
Sequence Length
447
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,636 Da
NCBI Official Full Name
Homo sapiens endothelial differentiation-related factor 1, mRNA
NCBI Official Synonym Full Names
endothelial differentiation related factor 1
NCBI Official Symbol
EDF1
NCBI Official Synonym Symbols
MBF1; EDF-1; CFAP280
NCBI Protein Information
endothelial differentiation-related factor 1
UniProt Protein Name
Endothelial differentiation-related factor 1
UniProt Gene Name
EDF1
UniProt Synonym Gene Names
EDF-1; MBF1
UniProt Entry Name
EDF1_HUMAN

NCBI Description

This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Uniprot Description

EDF1: Transcriptional coactivator stimulating NR5A1 and ligand-dependent NR1H3/LXRA and PPARG transcriptional activities. Enhances the DNA-binding activity of ATF1, ATF2, CREB1 and NR5A1. Regulates nitric oxid synthase activity probably by sequestering calmodulin in the cytoplasm. May function in endothelial cells differentiation, hormone-induced cardiomyocytes hypertrophy and lipid metabolism. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; DNA-binding; Transcription, coactivator/corepressor; RNA-binding

Chromosomal Location of Human Ortholog: 9q34.3

Cellular Component: cytoplasm; intracellular; nucleolus; nucleus; transcription factor TFIID complex

Molecular Function: histone acetyltransferase activity; methyltransferase activity; protein binding; transcription coactivator activity; transcription factor activity

Biological Process: endothelial cell differentiation; positive regulation of DNA binding; positive regulation of transcription, DNA-dependent; regulation of lipid metabolic process; regulation of transcription, DNA-dependent

Research Articles on EDF1

Similar Products

Product Notes

The EDF1 edf1 (Catalog #AAA1270695) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgaga gcgactggga cacggtgacg gtgctgcgca agaagggccc tacggccgcc caggccaaat ccaagcaggc tatcttagcg gcacagagac gaggagaaga tgtggagact tccaagaaat gggctgctgg ccagaacaaa caacattcta ttaccaagaa cacggccaag ctggaccggg agacagagga gctgcaccat gacagggtga ccctggaggt gggcaaggtg atccagcaag gtcggcagag caaggggctt acgcagaagg acctggccac gaaaatcaat gagaagccac aggtgatcgc ggactatgag agcggacggg ccatacccaa taaccaggtg cttggcaaaa tcgagcgggc cattggcctc aagctccggg gaaaggacat tggaaagccc atcgagaagg ggcctagggc gaaatga. It is sometimes possible for the material contained within the vial of "EDF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.