Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EDC3 cdna clone

EDC3 cDNA Clone

Gene Names
EDC3; YJDC; LSM16; MRT50; YJEFN2
Synonyms
EDC3; EDC3 cDNA Clone; EDC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggctacagattggctgggaagtattgtgtccatcaattgtggagatagcttgggtgtctatcagggaagagtgtcagctgtggatcaggtcagccagaccatttctctcacccggcctttccataatggagtgaagtgtcttgttccagaagtcaccttcagggcaggtgacattacggagttaaaaattctggagataccaggacctggagacaaccaacattttggagaccttcatcaaacagaattaggcccctctggtgctggctgccaagtgggcatcaatcagaatggcacaggcaagtttgtcaagaagccagcctcttccagcagtgcccctcagaatatccctaagaggacagatgtgaagagccaggatgttgccgtttccccgcagcagcaacagtgctcaaagagctatgtcgacaggcacatggaatccttgagtcagtccaaaagtttccgtcgtcggcacaactcctggtcatctagtagcaggcacccaaatcaggcaactcccaagaaaagtggtttaaagaatggccagatgaagaataaagatgacgagtgcttcggggatgatattgaggagatcccagacacagattttgattttgaagggaacctggctctttttgacaaggcagctgtgtttgaggagattgatacctatgaaaggagaagtggtacccgttcccggggcatcccaaatgaaaggcccactcggtaccgccatgatgagaacatcttggagtccgagcccattgtctatcgacggatcatagtgccccacaacgtgagcaaggagttctgcacggactctggcctggttgtcccaagtatttcctatgagctgcataaaaagctgttgtccgtggctgagaagcatgggctgacccttgagcggagactggagatgacaggtgtgtgtgccagtcagatggcactgaccctcctcggaggacctaacaggttgaatcccaaaaatgttcaccagaggcctacagtggctctactgtgtggacctcatgtgaagggggctcagggtatcagctgtggaaggcacctagccaaccatgatgtccaggtcatccttttcctgcccaattttgtcaagatgttggaatctatcaccaatgagctgtcgctcttcagcaagacccaaggccaacaagtgtctagcctcaaagatctgcccactagccctgtggacctggtcatcaactgcctggattgccctgagaacgtcttcctgcgcgatcaaccctggtacaaggcagctgtggcctgggccaaccagaaccgggcaccagtactcagcatagaccctcctgtgcatgaagtcgaacagggcattgatgccaaatggtcactggcactgggcctgcctctgccactgggggagcacgcaggccgtatctatttgtgcgacattggcattccccagcaggtcttccaggaggtgggcatcaactaccactcgccctttggctgcaagtttgttatcccactgcactctgcttag
Sequence Length
1527
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,078 Da
NCBI Official Full Name
Homo sapiens enhancer of mRNA decapping 3 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
enhancer of mRNA decapping 3
NCBI Official Symbol
EDC3
NCBI Official Synonym Symbols
YJDC; LSM16; MRT50; YJEFN2
NCBI Protein Information
enhancer of mRNA-decapping protein 3
UniProt Protein Name
Enhancer of mRNA-decapping protein 3
UniProt Gene Name
EDC3
UniProt Synonym Gene Names
LSM16; YJDC; YJEFN2; YjeF_N2; hYjeF_N2
UniProt Entry Name
EDC3_HUMAN

NCBI Description

EDC3 is associated with an mRNA-decapping complex required for removal of the 5-prime cap from mRNA prior to its degradation from the 5-prime end (Fenger-Gron et al., 2005 [PubMed 16364915]).[supplied by OMIM, Mar 2008]

Uniprot Description

EDC3: Binds single-stranded RNA. In the process of mRNA degradation, may play a role in mRNA decapping. May play a role in spermiogenesis and oogenesis. Belongs to the EDC3 family.

Protein type: RNA processing

Chromosomal Location of Human Ortholog: 15q24.1

Cellular Component: cytosol; membrane

Molecular Function: identical protein binding; mRNA binding; protein binding

Biological Process: cytoplasmic mRNA processing body assembly; deadenylation-independent decapping

Disease: Mental Retardation, Autosomal Recessive 50

Research Articles on EDC3

Similar Products

Product Notes

The EDC3 edc3 (Catalog #AAA1274941) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctacag attggctggg aagtattgtg tccatcaatt gtggagatag cttgggtgtc tatcagggaa gagtgtcagc tgtggatcag gtcagccaga ccatttctct cacccggcct ttccataatg gagtgaagtg tcttgttcca gaagtcacct tcagggcagg tgacattacg gagttaaaaa ttctggagat accaggacct ggagacaacc aacattttgg agaccttcat caaacagaat taggcccctc tggtgctggc tgccaagtgg gcatcaatca gaatggcaca ggcaagtttg tcaagaagcc agcctcttcc agcagtgccc ctcagaatat ccctaagagg acagatgtga agagccagga tgttgccgtt tccccgcagc agcaacagtg ctcaaagagc tatgtcgaca ggcacatgga atccttgagt cagtccaaaa gtttccgtcg tcggcacaac tcctggtcat ctagtagcag gcacccaaat caggcaactc ccaagaaaag tggtttaaag aatggccaga tgaagaataa agatgacgag tgcttcgggg atgatattga ggagatccca gacacagatt ttgattttga agggaacctg gctctttttg acaaggcagc tgtgtttgag gagattgata cctatgaaag gagaagtggt acccgttccc ggggcatccc aaatgaaagg cccactcggt accgccatga tgagaacatc ttggagtccg agcccattgt ctatcgacgg atcatagtgc cccacaacgt gagcaaggag ttctgcacgg actctggcct ggttgtccca agtatttcct atgagctgca taaaaagctg ttgtccgtgg ctgagaagca tgggctgacc cttgagcgga gactggagat gacaggtgtg tgtgccagtc agatggcact gaccctcctc ggaggaccta acaggttgaa tcccaaaaat gttcaccaga ggcctacagt ggctctactg tgtggacctc atgtgaaggg ggctcagggt atcagctgtg gaaggcacct agccaaccat gatgtccagg tcatcctttt cctgcccaat tttgtcaaga tgttggaatc tatcaccaat gagctgtcgc tcttcagcaa gacccaaggc caacaagtgt ctagcctcaa agatctgccc actagccctg tggacctggt catcaactgc ctggattgcc ctgagaacgt cttcctgcgc gatcaaccct ggtacaaggc agctgtggcc tgggccaacc agaaccgggc accagtactc agcatagacc ctcctgtgca tgaagtcgaa cagggcattg atgccaaatg gtcactggca ctgggcctgc ctctgccact gggggagcac gcaggccgta tctatttgtg cgacattggc attccccagc aggtcttcca ggaggtgggc atcaactacc actcgccctt tggctgcaag tttgttatcc cactgcactc tgcttag. It is sometimes possible for the material contained within the vial of "EDC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.