Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

E4F1 cdna clone

E4F1 cDNA Clone

Gene Names
E4F1; E4F
Synonyms
E4F1; E4F1 cDNA Clone; E4F1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagggcgcgatggcagtgcgggtgacggccgctcatacggcagaagcccaggccgaagccgggcgggaagcgggcgagggtgcagttgcggcggtggcggcggccttggcccccagcggcttcctcggcctcccggcgcccttcagcgaggaagatgaggacgatgtgcacagatgcggccgctgccaggcagagttcaccgccttggaggattttgttcagcacaagattcagaaggcctgccagcgggcccctccggaggccctgcctgccacccctgccaccacagcgttgctgggccaggaggtggtgccggcagcaccaggcccagaggagcccatcactgtggcccacatcgtggtggaggcggcctctctggcagcagacatcagccacgcatctgaccttgttggtggtgggcacatcaaagaggtcatcgtggctgctgaggcggagctgggagacggtgagatggccgaggccccgggcagcccccaccagcaggggctggggctcgcaggggagggtgagcaggcccaggtgaagctactggtgaacaaggatggccgctatgtgtgtgcgctgtgccacaagaccttcaagacgggcagcatcctcaaggcccacatggtcactcacagcagccgcaaggaccacgagtgcaagctctgtggggcctccttccgcaccaagggctcactcatccggcaccaccggcggcacacggatgagcgcccctacaagtgctccaagtgtggaaagagcttccgggagtcgggtgcactgacccggcacctcaagtctctcaccccctgcacagagaaaatccgcttcagtgtgagcaaggacgtggttgtcagcaaagaggacgcacgtgcaggttctggagctggagctgccggcttggggacagccacatcatcggtgacaggcgagcctatagagacttcacccgtgattcacctggtgacagatgccaagggcaccgtcatccacgaagtccacgtccagatgcaggagctgtccctgggcatgaaagccctggccccagagccccccgtctcccaggagctcccctgctccagcgagggcagccgtgagaacctgctgcaccaggccatgcagaactccggcatcgtccttgagcgcgctgctggggaggagggtgccctggagccagctcctgctgccgggtccagtccccagcccctggcagtggcagccccgcagctgccggtactggaagtgcagccgctggagacacaggtggccagcgaggcctcagcggtgcccaggacccacccatgtcctcagtgcagtgagaccttcccgacagcagccaccctggaggcccacaagaggggccacaccgggccgaggccgttcgcctgcgcgcagtgtggcaaggccttccccaaggcctacctgctcaagaagcaccaggaggtgcacgtgcgtgagcgccgcttccgctgtggcgactgcgggaagctctacaagaccattgcccatgtgcgtggccaccggcgcgtccactcagacgagcggccctacccttgtcccaagtgtggcaagcgctacaagactaagaacgcacagcaggtgcacttcaggacacacctggaggagaagccgcacgtgtgccagttctgcagccgtggcttccgagagaagggctcactggtgcggcacgtgcgacaccacacaggcgagaagccgttcaagtgctacaagtgcggccgtggcttcgccgagcacggcacgctgaaccggcacctgcgcaccaaagggggctgcctgctggaggtggaggagttgctggtgtctgaggacagccccgcggcagccaccaccgtcctcacggaagacccgcacacagtgccactgcggacgatgcggagaccagtgaggccacggagatcatcgagggcacccagacagaggtggacagccacatcatga
Sequence Length
1965
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
83,496 Da
NCBI Official Full Name
Homo sapiens E4F transcription factor 1, mRNA
NCBI Official Synonym Full Names
E4F transcription factor 1
NCBI Official Symbol
E4F1
NCBI Official Synonym Symbols
E4F
NCBI Protein Information
transcription factor E4F1
UniProt Protein Name
Transcription factor E4F1
Protein Family
UniProt Gene Name
E4F1
UniProt Synonym Gene Names
E4F
UniProt Entry Name
E4F1_HUMAN

NCBI Description

The zinc finger protein encoded by this gene is one of several cellular transcription factors whose DNA-binding activities are regulated through the action of adenovirus E1A. A 50-kDa amino-terminal product is generated from the full-length protein through proteolytic cleavage. The protein is differentially regulated by E1A-induced phosphorylation. The full-length gene product represses transcription from the E4 promoter in the absence of E1A, while the 50-kDa form acts as a transcriptional activator in its presence. Alternative splicing results in multiple transcripts encoding different proteins. [provided by RefSeq, Jan 2014]

Uniprot Description

E4F1: May function as a transcriptional repressor. May also function as a ubiquitin ligase mediating ubiquitination of chromatin-associated TP53. Functions in cell survival and proliferation through control of the cell cycle. Functions in the p53 and pRB tumor suppressor pathways and regulates the cyclin CCNA2 transcription.

Protein type: Ligase; DNA-binding; Transcription factor; C2H2-type zinc finger protein; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: nucleoplasm

Molecular Function: DNA binding; protein binding; transcription coactivator activity; transcription corepressor activity; transcription factor activity

Biological Process: cell proliferation; negative regulation of transcription from RNA polymerase II promoter

Research Articles on E4F1

Similar Products

Product Notes

The E4F1 e4f1 (Catalog #AAA1267780) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggcg cgatggcagt gcgggtgacg gccgctcata cggcagaagc ccaggccgaa gccgggcggg aagcgggcga gggtgcagtt gcggcggtgg cggcggcctt ggcccccagc ggcttcctcg gcctcccggc gcccttcagc gaggaagatg aggacgatgt gcacagatgc ggccgctgcc aggcagagtt caccgccttg gaggattttg ttcagcacaa gattcagaag gcctgccagc gggcccctcc ggaggccctg cctgccaccc ctgccaccac agcgttgctg ggccaggagg tggtgccggc agcaccaggc ccagaggagc ccatcactgt ggcccacatc gtggtggagg cggcctctct ggcagcagac atcagccacg catctgacct tgttggtggt gggcacatca aagaggtcat cgtggctgct gaggcggagc tgggagacgg tgagatggcc gaggccccgg gcagccccca ccagcagggg ctggggctcg caggggaggg tgagcaggcc caggtgaagc tactggtgaa caaggatggc cgctatgtgt gtgcgctgtg ccacaagacc ttcaagacgg gcagcatcct caaggcccac atggtcactc acagcagccg caaggaccac gagtgcaagc tctgtggggc ctccttccgc accaagggct cactcatccg gcaccaccgg cggcacacgg atgagcgccc ctacaagtgc tccaagtgtg gaaagagctt ccgggagtcg ggtgcactga cccggcacct caagtctctc accccctgca cagagaaaat ccgcttcagt gtgagcaagg acgtggttgt cagcaaagag gacgcacgtg caggttctgg agctggagct gccggcttgg ggacagccac atcatcggtg acaggcgagc ctatagagac ttcacccgtg attcacctgg tgacagatgc caagggcacc gtcatccacg aagtccacgt ccagatgcag gagctgtccc tgggcatgaa agccctggcc ccagagcccc ccgtctccca ggagctcccc tgctccagcg agggcagccg tgagaacctg ctgcaccagg ccatgcagaa ctccggcatc gtccttgagc gcgctgctgg ggaggagggt gccctggagc cagctcctgc tgccgggtcc agtccccagc ccctggcagt ggcagccccg cagctgccgg tactggaagt gcagccgctg gagacacagg tggccagcga ggcctcagcg gtgcccagga cccacccatg tcctcagtgc agtgagacct tcccgacagc agccaccctg gaggcccaca agaggggcca caccgggccg aggccgttcg cctgcgcgca gtgtggcaag gccttcccca aggcctacct gctcaagaag caccaggagg tgcacgtgcg tgagcgccgc ttccgctgtg gcgactgcgg gaagctctac aagaccattg cccatgtgcg tggccaccgg cgcgtccact cagacgagcg gccctaccct tgtcccaagt gtggcaagcg ctacaagact aagaacgcac agcaggtgca cttcaggaca cacctggagg agaagccgca cgtgtgccag ttctgcagcc gtggcttccg agagaagggc tcactggtgc ggcacgtgcg acaccacaca ggcgagaagc cgttcaagtg ctacaagtgc ggccgtggct tcgccgagca cggcacgctg aaccggcacc tgcgcaccaa agggggctgc ctgctggagg tggaggagtt gctggtgtct gaggacagcc ccgcggcagc caccaccgtc ctcacggaag acccgcacac agtgccactg cggacgatgc ggagaccagt gaggccacgg agatcatcga gggcacccag acagaggtgg acagccacat catga. It is sometimes possible for the material contained within the vial of "E4F1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.