Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DYRK2 cdna clone

DYRK2 cDNA Clone

Synonyms
DYRK2; DYRK2 cDNA Clone; DYRK2 cdna clone
Ordering
For Research Use Only!
Sequence
atgttaaccaggaaaccttcggccgccgctcccgccgcctacccgaccggccgaggtggggacagcgccgttcgtcagcttcaggcttccccggggctcggtgcaggggccacccggagcggagtggggactggcccgccctcccccatcgccctgccgcctctccgggccagcaacgctgccgccgcagcccacacgattggcggcagtaagcacacaatgaatgatcacctgcatgtcggcagccacgctcacggacagatccaggttcaacagttgtttgaggataacagtaacaagcggacagtgctcacgacacaaccaaatgggcttacaacagtgggcaaaacgggcttgccagtggtgccagagcggcagctggacagcattcatagacggcaggggagctccacctctctaaagtccatggaaggcatggggaaggtgaaagccacccccatgacacctgaacaagcaatgaagcaatacatgcaaaaactcacagccttcgaacaccatgagattttcagctaccctgaaatatatttcttgggtctaaatgctaagaagcgccagggcatgacaggtgggcccaacaatggtggctatgatgatgaccagggatcatatgtgcaggtgccccacgatcacgtggcttacaggtatgaggtcctcaaggtcattgggaaggggagctttgggcaggtggtcaaggcctacgatcacaaagtccaccagcacgtggccctaaagatggtgcggaatgagaagcgcttccaccggcaagcagcggaggagatccgaatcctggaacacctgcggaagcaggacaaggataacacaatgaatgtcatccatatgctggagaatttcaccttccgcaaccacatctgcatgacgtttgagctgctgagcatgaacctctatgagctcatcaagaagaataaattccagggcttcagtctgcctttggttcgcaagtttgcccactcgattctgcagtgcttggatgctttgcacaaaaacagaataattcactgtgaccttaagcccgagaacattttgttaaagcagcagggtagaagcggtattaaagtaattgattttggctccagttgttacgagcatcagcgtgtctacacgtacatccagtcgcgtttttaccgggctccagaagtgatccttggggccaggtatggcatgcccattgatatgtggagcctgggctgcattttagcagagctcctgacgggttaccccctcttgcctggggaagatgaaggggaccagctggcctgtatgattgaactgttgggcatgccctcacagaaactgctggatgcatccaaacgagccaaaaattttgtgagctccaagggttatccccgttactgcactgtcacgactctctcagatggctctgtggtcctaaacggaggccgttcccggagggggaaactgaggggcccaccggagagcagagagtgggggaacgcgctgaaggggtgtgatgatccccttttccttgacttcttaaaacagtgtttagagtgggatcctgcagtgcgcatgaccccaggccaggctttgcggcacccctggctgaggaggcggttgccaaagcctcccaccggggagaaaacgtcagtgaaaaggataactgagagcaccggtgctatcacatctatatccaagttacctccaccttctagctcagcttccaaactgaggactaatttggcgcagatgacagatgccaatgggaatattcagcagaggacagtgttgccaaaacttgttagctga
Sequence Length
1806
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,715 Da
NCBI Official Full Name
Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2, mRNA
NCBI Official Synonym Full Names
dual specificity tyrosine phosphorylation regulated kinase 2
NCBI Official Symbol
DYRK2
NCBI Protein Information
dual specificity tyrosine-phosphorylation-regulated kinase 2
UniProt Protein Name
Dual specificity tyrosine-phosphorylation-regulated kinase 2
UniProt Gene Name
DYRK2
UniProt Entry Name
DYRK2_HUMAN

NCBI Description

DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]

Uniprot Description

DYRK2: a dual-specificity protein kinase of the DYRK family. Localizes in the cytoplasm. Phosphorylates the translation initiation factor eIF2B at Ser539, priming it for phosphorylation by glycogen synthase kinase-3.

Protein type: Kinase, protein; Protein kinase, CMGC; Protein kinase, dual-specificity (non-receptor); EC 2.7.12.1; CMGC group; DYRK family; Dyrk2 subfamily

Chromosomal Location of Human Ortholog: 12q15

Cellular Component: cytoplasm; nucleoplasm; nucleus; ubiquitin ligase complex

Molecular Function: ATP binding; magnesium ion binding; manganese ion binding; protein binding; protein serine/threonine kinase activity; protein-tyrosine kinase activity; ubiquitin binding

Biological Process: DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; negative regulation of NFAT protein import into nucleus; positive regulation of glycogen biosynthetic process; protein amino acid phosphorylation; response to DNA damage stimulus; smoothened signaling pathway

Research Articles on DYRK2

Similar Products

Product Notes

The DYRK2 dyrk2 (Catalog #AAA1277046) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttaacca ggaaaccttc ggccgccgct cccgccgcct acccgaccgg ccgaggtggg gacagcgccg ttcgtcagct tcaggcttcc ccggggctcg gtgcaggggc cacccggagc ggagtgggga ctggcccgcc ctcccccatc gccctgccgc ctctccgggc cagcaacgct gccgccgcag cccacacgat tggcggcagt aagcacacaa tgaatgatca cctgcatgtc ggcagccacg ctcacggaca gatccaggtt caacagttgt ttgaggataa cagtaacaag cggacagtgc tcacgacaca accaaatggg cttacaacag tgggcaaaac gggcttgcca gtggtgccag agcggcagct ggacagcatt catagacggc aggggagctc cacctctcta aagtccatgg aaggcatggg gaaggtgaaa gccaccccca tgacacctga acaagcaatg aagcaataca tgcaaaaact cacagccttc gaacaccatg agattttcag ctaccctgaa atatatttct tgggtctaaa tgctaagaag cgccagggca tgacaggtgg gcccaacaat ggtggctatg atgatgacca gggatcatat gtgcaggtgc cccacgatca cgtggcttac aggtatgagg tcctcaaggt cattgggaag gggagctttg ggcaggtggt caaggcctac gatcacaaag tccaccagca cgtggcccta aagatggtgc ggaatgagaa gcgcttccac cggcaagcag cggaggagat ccgaatcctg gaacacctgc ggaagcagga caaggataac acaatgaatg tcatccatat gctggagaat ttcaccttcc gcaaccacat ctgcatgacg tttgagctgc tgagcatgaa cctctatgag ctcatcaaga agaataaatt ccagggcttc agtctgcctt tggttcgcaa gtttgcccac tcgattctgc agtgcttgga tgctttgcac aaaaacagaa taattcactg tgaccttaag cccgagaaca ttttgttaaa gcagcagggt agaagcggta ttaaagtaat tgattttggc tccagttgtt acgagcatca gcgtgtctac acgtacatcc agtcgcgttt ttaccgggct ccagaagtga tccttggggc caggtatggc atgcccattg atatgtggag cctgggctgc attttagcag agctcctgac gggttacccc ctcttgcctg gggaagatga aggggaccag ctggcctgta tgattgaact gttgggcatg ccctcacaga aactgctgga tgcatccaaa cgagccaaaa attttgtgag ctccaagggt tatccccgtt actgcactgt cacgactctc tcagatggct ctgtggtcct aaacggaggc cgttcccgga gggggaaact gaggggccca ccggagagca gagagtgggg gaacgcgctg aaggggtgtg atgatcccct tttccttgac ttcttaaaac agtgtttaga gtgggatcct gcagtgcgca tgaccccagg ccaggctttg cggcacccct ggctgaggag gcggttgcca aagcctccca ccggggagaa aacgtcagtg aaaaggataa ctgagagcac cggtgctatc acatctatat ccaagttacc tccaccttct agctcagctt ccaaactgag gactaatttg gcgcagatga cagatgccaa tgggaatatt cagcagagga cagtgttgcc aaaacttgtt agctga. It is sometimes possible for the material contained within the vial of "DYRK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.