Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DYNLT3 cdna clone

DYNLT3 cDNA Clone

Gene Names
DYNLT3; RP3; TCTE1L; TCTEX1L
Synonyms
DYNLT3; DYNLT3 cDNA Clone; DYNLT3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagtaccatcgccactgcgacgaggttggcttcaatgctgaggaagcccacaatattgtcaaagagtgtgtagatggggttttaggtggtgaagattataatcacaacaacatcaaccagtggactgcaagcatagtggaacaatccttaacacacctggttaagttgggaaaagcctataaatatattgtgacctgtgcagtggtccagaagagcgcatatggctttcacacagccagctcctgtttttgggataccacatctgatggaacctgtaccgtaagatgggagaaccggaccatgaactgtattgtcaacgtttttgccattgctattgttctttaa
Sequence Length
351
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,062 Da
NCBI Official Full Name
Homo sapiens dynein, light chain, Tctex-type 3, mRNA
NCBI Official Synonym Full Names
dynein light chain Tctex-type 3
NCBI Official Symbol
DYNLT3
NCBI Official Synonym Symbols
RP3; TCTE1L; TCTEX1L
NCBI Protein Information
dynein light chain Tctex-type 3
UniProt Protein Name
Dynein light chain Tctex-type 3
Protein Family
UniProt Gene Name
DYNLT3
UniProt Synonym Gene Names
TCTE1L; TCTE1XL
UniProt Entry Name
DYLT3_HUMAN

NCBI Description

This gene encodes a member of a subclass of dynein light chains. The encoded protein homodimerizes and forms the light chain component of the cytoplasmic dynein motor protein complex. This protein may be important for binding dynein to specific cargos including the spindle checkpoint protein BUB3. This protein may also function independently of dynein as a transcriptional modulator. Pseudogenes of this gene are found on chromosomes 2 and 20.[provided by RefSeq, Mar 2010]

Uniprot Description

DYNLT3: Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Probably binds BUB3 as part of transport cargo. Required for the efficient progression through mitosis. Belongs to the dynein light chain Tctex-type family.

Protein type: Motor; Microtubule-binding

Chromosomal Location of Human Ortholog: Xp21

Cellular Component: cytoplasmic dynein complex; kinetochore

Molecular Function: protein binding

Biological Process: regulation of mitotic cell cycle

Research Articles on DYNLT3

Similar Products

Product Notes

The DYNLT3 dynlt3 (Catalog #AAA1271301) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagt accatcgcca ctgcgacgag gttggcttca atgctgagga agcccacaat attgtcaaag agtgtgtaga tggggtttta ggtggtgaag attataatca caacaacatc aaccagtgga ctgcaagcat agtggaacaa tccttaacac acctggttaa gttgggaaaa gcctataaat atattgtgac ctgtgcagtg gtccagaaga gcgcatatgg ctttcacaca gccagctcct gtttttggga taccacatct gatggaacct gtaccgtaag atgggagaac cggaccatga actgtattgt caacgttttt gccattgcta ttgttcttta a. It is sometimes possible for the material contained within the vial of "DYNLT3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.