Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DYNC1I1 cdna clone

DYNC1I1 cDNA Clone

Gene Names
DYNC1I1; DNCI1; DNCIC1
Synonyms
DYNC1I1; DYNC1I1 cDNA Clone; DYNC1I1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgacaaaagtgacttaaaagctgagctagagcgcaaaaagcagcgcttagcacagataagagaagagaagaaacggaaggaagaggagaggaaaaagaaagaggctgatatgcagcagaagaaagaacccgttcaggacgactctgatctggatcgcaaacgacgagagacagaggctttgctgcaaagcattggtatctcaccggagccgcctctagtgcagccgctgcattttttaacatgggatacctgttattttcattatttagtcccaacccctatgtctccctcctcgaaatcagtgagcactcccagtgaagctggaagccaagactcaggcgatctggggccattaacaagaagaagactgcataaactgggcgtgtcaaaggtcacccaagtggatttcctgccaagggaagtagtgtcctactcaaaggagacccagactcctcttgccacgcatcagtctgaagaggatgaggaagatgaggaaatggtggaatctaaagttggccaggactcagaactggaaaatcaggacaaaaaacaggaagtgaaggaagcccctccaagagagttgacagaggaagaaaaacagcagatccttcattcagaggaatttctcatcttttttgaccggacaatacgggtaattgaaagagccctggctgaagattccgacatcttttttgactacagcggccgagagttagaggaaaaagatggggatgttcaggctggagccaatctttctttcaatcgtcagttctatgatgaacattggtccaagcatcgagtggtcacttgtatggactggtccctccagtaccctgagctgatggtggcttcttacaacaacaatgaagatgctccccatgaaccagatggagtggccttggtttggaacatgaagtttaagaaaaccacaccagaatacgtcttccactgtcagtcctctgtgatgtcggtctgcttcgcccgtttccatcctaacttggtggttggtgggacttactcgggccagattgtcctctgggacaatcgcagtcatcgaaggactccagtgcagcggacacccttatcagctgctgcacacacgcatcccgtgtactgtgtaaatgttgttgggacccagaatgctcataacctcatcactgtctccactgatggcaaaatgtgttcctggagcctggacatgctctcaactccacaggagagcatggagctggtgtacaataagtccaagcctgtcgctgttaccggaatggctttcccaacgggagacgtcaataacttcgtggttggcagtgaggaaggtacagtctacacggcttgtcgtcatggaagcaaagcaggtattggtgaggtctttgaaggtcaccaagggccagtgacaggaattaactgccacatggcagtgggaccaatcgacttttctcacctgtttgtcacatcatcatttgactggactgtcaaactgtgtaccaccaagcacaacaagccgctctactcctttgaagacaatgcagactatgtgtacgatgtcatgtggtcccccgtgcatcctgcgctttttgcctgcgtggacgggatggggcgcttggacctctggaacctcaacaatgacaccgaggttccaacagcaagtgtggccattgagggggcatccgccctaaaccgtgttcgttgggcccaagctggcaaagaagttgctgttggggactcagaaggccgtatttgggtctatgacgttggagagcttgcagttccccacaatgatgaatggacccgatttgccaggacccttgtggaaattcgtgctaacagagctgatagcgaggaggaaggcactgttgagttatctgcctag
Sequence Length
1878
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,741 Da
NCBI Official Full Name
Homo sapiens dynein, cytoplasmic 1, intermediate chain 1, mRNA
NCBI Official Synonym Full Names
dynein cytoplasmic 1 intermediate chain 1
NCBI Official Symbol
DYNC1I1
NCBI Official Synonym Symbols
DNCI1; DNCIC1
NCBI Protein Information
cytoplasmic dynein 1 intermediate chain 1
UniProt Protein Name
Cytoplasmic dynein 1 intermediate chain 1
Protein Family
UniProt Gene Name
DYNC1I1
UniProt Synonym Gene Names
DNCI1; DNCIC1; DH IC-1
UniProt Entry Name
DC1I1_HUMAN

Uniprot Description

Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. The intermediate chains mediate the binding of dynein to dynactin via its 150 kDa component (p150-glued) DCNT1. May play a role in mediating the interaction of cytoplasmic dynein with membranous organelles and kinetochores.

Research Articles on DYNC1I1

Similar Products

Product Notes

The DYNC1I1 dync1i1 (Catalog #AAA1270669) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgaca aaagtgactt aaaagctgag ctagagcgca aaaagcagcg cttagcacag ataagagaag agaagaaacg gaaggaagag gagaggaaaa agaaagaggc tgatatgcag cagaagaaag aacccgttca ggacgactct gatctggatc gcaaacgacg agagacagag gctttgctgc aaagcattgg tatctcaccg gagccgcctc tagtgcagcc gctgcatttt ttaacatggg atacctgtta ttttcattat ttagtcccaa cccctatgtc tccctcctcg aaatcagtga gcactcccag tgaagctgga agccaagact caggcgatct ggggccatta acaagaagaa gactgcataa actgggcgtg tcaaaggtca cccaagtgga tttcctgcca agggaagtag tgtcctactc aaaggagacc cagactcctc ttgccacgca tcagtctgaa gaggatgagg aagatgagga aatggtggaa tctaaagttg gccaggactc agaactggaa aatcaggaca aaaaacagga agtgaaggaa gcccctccaa gagagttgac agaggaagaa aaacagcaga tccttcattc agaggaattt ctcatctttt ttgaccggac aatacgggta attgaaagag ccctggctga agattccgac atcttttttg actacagcgg ccgagagtta gaggaaaaag atggggatgt tcaggctgga gccaatcttt ctttcaatcg tcagttctat gatgaacatt ggtccaagca tcgagtggtc acttgtatgg actggtccct ccagtaccct gagctgatgg tggcttctta caacaacaat gaagatgctc cccatgaacc agatggagtg gccttggttt ggaacatgaa gtttaagaaa accacaccag aatacgtctt ccactgtcag tcctctgtga tgtcggtctg cttcgcccgt ttccatccta acttggtggt tggtgggact tactcgggcc agattgtcct ctgggacaat cgcagtcatc gaaggactcc agtgcagcgg acacccttat cagctgctgc acacacgcat cccgtgtact gtgtaaatgt tgttgggacc cagaatgctc ataacctcat cactgtctcc actgatggca aaatgtgttc ctggagcctg gacatgctct caactccaca ggagagcatg gagctggtgt acaataagtc caagcctgtc gctgttaccg gaatggcttt cccaacggga gacgtcaata acttcgtggt tggcagtgag gaaggtacag tctacacggc ttgtcgtcat ggaagcaaag caggtattgg tgaggtcttt gaaggtcacc aagggccagt gacaggaatt aactgccaca tggcagtggg accaatcgac ttttctcacc tgtttgtcac atcatcattt gactggactg tcaaactgtg taccaccaag cacaacaagc cgctctactc ctttgaagac aatgcagact atgtgtacga tgtcatgtgg tcccccgtgc atcctgcgct ttttgcctgc gtggacggga tggggcgctt ggacctctgg aacctcaaca atgacaccga ggttccaaca gcaagtgtgg ccattgaggg ggcatccgcc ctaaaccgtg ttcgttgggc ccaagctggc aaagaagttg ctgttgggga ctcagaaggc cgtatttggg tctatgacgt tggagagctt gcagttcccc acaatgatga atggacccga tttgccagga cccttgtgga aattcgtgct aacagagctg atagcgagga ggaaggcact gttgagttat ctgcctag. It is sometimes possible for the material contained within the vial of "DYNC1I1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.